Incidental Mutation 'R1842:Gad1'
ID 205799
Institutional Source Beutler Lab
Gene Symbol Gad1
Ensembl Gene ENSMUSG00000070880
Gene Name glutamate decarboxylase 1
Synonyms GAD25, GAD67, Gad-1, Z49976, GAD44, EP10
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1842 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 70553072-70602014 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70574253 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 162 (E162D)
Ref Sequence ENSEMBL: ENSMUSP00000119733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094934] [ENSMUST00000123330] [ENSMUST00000130604] [ENSMUST00000130998] [ENSMUST00000148210]
AlphaFold P48318
Predicted Effect probably benign
Transcript: ENSMUST00000094934
AA Change: E162D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092539
Gene: ENSMUSG00000070880
AA Change: E162D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 517 7e-154 PFAM
Pfam:Beta_elim_lyase 231 375 3.2e-6 PFAM
Pfam:Aminotran_5 273 380 2.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123330
AA Change: E162D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116301
Gene: ENSMUSG00000070880
AA Change: E162D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 249 6.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130604
AA Change: E162D

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117721
Gene: ENSMUSG00000070880
AA Change: E162D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 218 2.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130998
AA Change: E162D

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119379
Gene: ENSMUSG00000070880
AA Change: E162D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 218 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140478
Predicted Effect probably benign
Transcript: ENSMUST00000148210
AA Change: E162D

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119733
Gene: ENSMUSG00000070880
AA Change: E162D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 218 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155979
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that catalyzes the production of gamma-aminobutyric acid from L-glutamic acid. Alternative splicing of this gene results in two products, the predominant 67 kDa isoform and a smaller 25 kDa isoform. The smaller isoform is not thought to retain catalytic activity. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at birth with cleft palate and apnea and exhibit reduced levels of glutamic acid decarboxylase and gamma-aminobutyric acid in the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Gad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Gad1 APN 2 70597168 missense probably benign
IGL01907:Gad1 APN 2 70574126 missense possibly damaging 0.64
IGL02596:Gad1 APN 2 70594684 missense probably damaging 1.00
IGL02654:Gad1 APN 2 70572781 missense possibly damaging 0.88
IGL02998:Gad1 APN 2 70589819 missense probably damaging 1.00
PIT4581001:Gad1 UTSW 2 70599667 missense probably benign 0.05
R0102:Gad1 UTSW 2 70587239 critical splice donor site probably null
R0454:Gad1 UTSW 2 70579201 missense probably damaging 1.00
R0576:Gad1 UTSW 2 70594652 missense probably benign 0.27
R1386:Gad1 UTSW 2 70574123 missense possibly damaging 0.88
R1677:Gad1 UTSW 2 70574177 missense probably damaging 1.00
R1907:Gad1 UTSW 2 70579138 missense possibly damaging 0.79
R1933:Gad1 UTSW 2 70587392 missense possibly damaging 0.91
R3029:Gad1 UTSW 2 70594690 missense probably benign
R4085:Gad1 UTSW 2 70589848 missense probably benign 0.36
R4321:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4324:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4687:Gad1 UTSW 2 70600720 missense possibly damaging 0.94
R4986:Gad1 UTSW 2 70600693 missense probably benign
R5387:Gad1 UTSW 2 70563851 nonsense probably null
R5603:Gad1 UTSW 2 70589829 missense probably damaging 0.98
R6500:Gad1 UTSW 2 70593436 missense probably damaging 0.98
R7146:Gad1 UTSW 2 70587362 missense probably benign 0.00
R7352:Gad1 UTSW 2 70594750 missense probably benign 0.00
R7559:Gad1 UTSW 2 70563912 critical splice donor site probably null
R7579:Gad1 UTSW 2 70587132 missense possibly damaging 0.90
R7809:Gad1 UTSW 2 70597259 missense possibly damaging 0.80
R7941:Gad1 UTSW 2 70594585 splice site probably null
R8290:Gad1 UTSW 2 70574266 missense probably benign 0.00
R8353:Gad1 UTSW 2 70600713 missense probably benign 0.00
R8453:Gad1 UTSW 2 70600713 missense probably benign 0.00
R9017:Gad1 UTSW 2 70585862 missense probably benign 0.01
R9207:Gad1 UTSW 2 70579202 critical splice donor site probably null
R9250:Gad1 UTSW 2 70579199 missense probably damaging 1.00
R9417:Gad1 UTSW 2 70587372 missense possibly damaging 0.75
R9433:Gad1 UTSW 2 70593463 missense
R9589:Gad1 UTSW 2 70585940 missense possibly damaging 0.93
R9620:Gad1 UTSW 2 70574276 missense possibly damaging 0.54
R9675:Gad1 UTSW 2 70585856 missense probably damaging 1.00
X0026:Gad1 UTSW 2 70589866 missense probably benign 0.00
Z1177:Gad1 UTSW 2 70579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCCAGCTAAGAACGGG -3'
(R):5'- AATGATGACCTTGTGCCAGGC -3'

Sequencing Primer
(F):5'- CGGGGAGGAGCAAACTGC -3'
(R):5'- GACCCATGGTGACCTTGTGATC -3'
Posted On 2014-06-23