Incidental Mutation 'R0113:Kcnk6'
ID20581
Institutional Source Beutler Lab
Gene Symbol Kcnk6
Ensembl Gene ENSMUSG00000046410
Gene Namepotassium inwardly-rectifying channel, subfamily K, member 6
SynonymsTwik2, Toss, D7Ertd764e
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0113 (G1)
Quality Score63
Status Validated (trace)
Chromosome7
Chromosomal Location29221926-29232515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29232209 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000082975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085818]
Predicted Effect probably damaging
Transcript: ENSMUST00000085818
AA Change: D92G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082975
Gene: ENSMUSG00000046410
AA Change: D92G

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Ion_trans_2 74 146 1.6e-17 PFAM
Pfam:Ion_trans_2 180 260 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208807
Meta Mutation Damage Score 0.5019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. This channel protein, considered an open rectifier, is widely expressed. It is stimulated by arachidonic acid, and inhibited by internal acidification and volatile anaesthetics. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit vascular dysfunction and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A Het
Kalrn A G 16: 34,049,936 probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in Kcnk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Kcnk6 APN 7 29225202 missense probably benign 0.01
R0057:Kcnk6 UTSW 7 29225663 missense probably damaging 1.00
R1888:Kcnk6 UTSW 7 29225650 missense probably benign 0.13
R1888:Kcnk6 UTSW 7 29225650 missense probably benign 0.13
R6781:Kcnk6 UTSW 7 29225055 missense probably damaging 1.00
R7250:Kcnk6 UTSW 7 29232194 missense probably benign 0.34
R7782:Kcnk6 UTSW 7 29225844 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGAATGGAGGTTGTTCTGAGAGCAC -3'
(R):5'- TTCAGGCAGGAAAGGACTCCGC -3'

Sequencing Primer
(F):5'- TTCTGAGAGCACCAGGACG -3'
(R):5'- TCAGTTTCCCAGCGTCAGG -3'
Posted On2013-04-11