Incidental Mutation 'R1842:Vmn2r23'
ID 205813
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 039867-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R1842 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123706649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 493 (V493D)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000172391
AA Change: V493D

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: V493D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G T 11: 110,087,865 (GRCm39) N1087K probably benign Het
Abcc3 G A 11: 94,250,438 (GRCm39) T921I probably benign Het
Abr T A 11: 76,399,812 (GRCm39) I4F probably damaging Het
Adcy10 T A 1: 165,330,812 (GRCm39) V25D probably damaging Het
Ahnak T A 19: 8,983,231 (GRCm39) M1505K probably damaging Het
Alms1-ps2 T C 6: 85,773,231 (GRCm39) noncoding transcript Het
Apob C G 12: 8,061,559 (GRCm39) T3347S probably damaging Het
Arhgap27 C A 11: 103,230,822 (GRCm39) G11W probably damaging Het
Ccdc110 A T 8: 46,393,605 (GRCm39) I106F probably damaging Het
Ccdc28b T A 4: 129,514,806 (GRCm39) D101V probably damaging Het
Ccdc30 T C 4: 119,188,324 (GRCm39) E566G probably benign Het
Cenpm T C 15: 82,123,565 (GRCm39) S111G probably benign Het
Cep55 A G 19: 38,046,348 (GRCm39) I34V probably benign Het
Dcdc2a T C 13: 25,291,585 (GRCm39) L190S probably damaging Het
Dhh T C 15: 98,792,441 (GRCm39) probably null Het
Dst A G 1: 34,203,200 (GRCm39) N703S probably null Het
E030025P04Rik G A 11: 109,030,396 (GRCm39) L164F unknown Het
Efcab5 A G 11: 77,025,701 (GRCm39) V538A probably benign Het
Egflam A G 15: 7,333,422 (GRCm39) S177P probably benign Het
Ehbp1l1 A T 19: 5,775,958 (GRCm39) C31S probably damaging Het
Eif2d C A 1: 131,098,797 (GRCm39) Q532K probably damaging Het
Elf3 T C 1: 135,184,531 (GRCm39) D175G possibly damaging Het
F5 T C 1: 164,012,129 (GRCm39) V449A probably damaging Het
Fam110a A T 2: 151,811,954 (GRCm39) I272N probably damaging Het
Fbxo34 A G 14: 47,768,464 (GRCm39) D608G probably damaging Het
Flrt2 T C 12: 95,746,058 (GRCm39) L132P probably damaging Het
Frg2f1 A T 4: 119,388,277 (GRCm39) V74D possibly damaging Het
Gad1 G T 2: 70,404,597 (GRCm39) E162D probably benign Het
Glb1l A G 1: 75,177,104 (GRCm39) V444A probably damaging Het
Gm10770 G A 2: 150,021,076 (GRCm39) T147I probably damaging Het
Gm43302 T C 5: 105,425,602 (GRCm39) I276V probably benign Het
Greb1 T C 12: 16,746,244 (GRCm39) H1314R probably damaging Het
Hapln2 A G 3: 87,931,308 (GRCm39) V69A probably damaging Het
Hcn1 T C 13: 118,112,544 (GRCm39) I836T probably damaging Het
Hspa5 A G 2: 34,665,815 (GRCm39) D553G probably damaging Het
Iqgap1 A T 7: 80,410,631 (GRCm39) I194N probably damaging Het
Kansl3 A G 1: 36,390,825 (GRCm39) V304A probably damaging Het
Kdm5d C T Y: 927,798 (GRCm39) S716L probably damaging Het
Klra6 T C 6: 129,999,573 (GRCm39) T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,224,352 (GRCm39) probably benign Het
Lrp1 A G 10: 127,409,337 (GRCm39) I1594T possibly damaging Het
Lrp2bp A G 8: 46,464,152 (GRCm39) D15G probably benign Het
Map4k1 T C 7: 28,686,588 (GRCm39) L170P probably damaging Het
Mast3 A G 8: 71,233,037 (GRCm39) F1108L possibly damaging Het
Mettl5 G T 2: 69,715,686 (GRCm39) L6I unknown Het
Mfsd14a A T 3: 116,426,057 (GRCm39) F447I possibly damaging Het
Mrc2 A G 11: 105,228,546 (GRCm39) I642V probably damaging Het
Necap1 A G 6: 122,851,547 (GRCm39) Y7C probably damaging Het
Nsd1 G A 13: 55,394,258 (GRCm39) E723K probably damaging Het
Nsun3 A T 16: 62,596,755 (GRCm39) L121H probably damaging Het
Nsun6 A T 2: 15,014,288 (GRCm39) M284K probably damaging Het
Nutf2 T C 8: 106,603,242 (GRCm39) probably null Het
Odad2 A T 18: 7,223,551 (GRCm39) D497E probably benign Het
Or1j20 A T 2: 36,759,601 (GRCm39) N8Y probably damaging Het
Or5d38 A T 2: 87,954,471 (GRCm39) M286K probably damaging Het
Pacs1 T C 19: 5,205,912 (GRCm39) E288G probably damaging Het
Peg10 A T 6: 4,756,381 (GRCm39) probably benign Het
Rab38 G A 7: 88,099,730 (GRCm39) E82K possibly damaging Het
Rgsl1 T A 1: 153,675,543 (GRCm39) E206V probably damaging Het
Saxo5 T A 8: 3,533,668 (GRCm39) F295L possibly damaging Het
Scube3 G A 17: 28,384,063 (GRCm39) V521I probably damaging Het
Sgpp1 C T 12: 75,762,982 (GRCm39) V400M probably damaging Het
Slc18b1 T C 10: 23,681,891 (GRCm39) S152P possibly damaging Het
Slit1 A T 19: 41,709,477 (GRCm39) probably null Het
Spata31d1e T C 13: 59,890,320 (GRCm39) Y82C probably damaging Het
Spta1 A G 1: 174,023,513 (GRCm39) K640R probably benign Het
Svil A G 18: 5,062,373 (GRCm39) T898A probably damaging Het
Timm44 A G 8: 4,310,510 (GRCm39) probably null Het
Tomm40 A G 7: 19,447,650 (GRCm39) S127P probably benign Het
Yeats2 T C 16: 19,989,988 (GRCm39) V288A probably damaging Het
Zfhx4 C T 3: 5,466,558 (GRCm39) R2239W probably damaging Het
Zscan2 A C 7: 80,525,301 (GRCm39) K341Q probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGTTGAATTGCATCTCATTG -3'
(R):5'- TTTGGCATTGGAAAGGACACAG -3'

Sequencing Primer
(F):5'- TTGCATCTCATTGACTTACAGTG -3'
(R):5'- CAGTAAGGAACTCTCAGCCTG -3'
Posted On 2014-06-23