Incidental Mutation 'R1842:Tomm40'
ID205815
Institutional Source Beutler Lab
Gene Symbol Tomm40
Ensembl Gene ENSMUSG00000002984
Gene Nametranslocase of outer mitochondrial membrane 40
SynonymsTom40
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1842 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19701313-19715438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19713725 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 127 (S127P)
Ref Sequence ENSEMBL: ENSMUSP00000104090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032555] [ENSMUST00000075447] [ENSMUST00000093552]
Predicted Effect probably benign
Transcript: ENSMUST00000032555
AA Change: S127P

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984
AA Change: S127P

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075447
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093552
AA Change: S127P

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984
AA Change: S127P

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174476
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Tomm40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Tomm40 APN 7 19703363 missense probably benign 0.13
IGL01766:Tomm40 APN 7 19703082 missense possibly damaging 0.93
IGL02831:Tomm40 APN 7 19703089 missense probably damaging 1.00
IGL03178:Tomm40 APN 7 19701834 missense probably damaging 0.98
PIT4131001:Tomm40 UTSW 7 19703091 missense probably damaging 1.00
R0280:Tomm40 UTSW 7 19713751 missense probably damaging 1.00
R1913:Tomm40 UTSW 7 19710961 missense probably damaging 0.98
R3702:Tomm40 UTSW 7 19713673 missense possibly damaging 0.89
R4685:Tomm40 UTSW 7 19701836 missense probably benign 0.06
R5165:Tomm40 UTSW 7 19713667 critical splice donor site probably null
R5380:Tomm40 UTSW 7 19701750 missense probably benign 0.27
R6026:Tomm40 UTSW 7 19710964 missense probably benign 0.43
R6236:Tomm40 UTSW 7 19703356 missense probably benign 0.15
R6994:Tomm40 UTSW 7 19702906 missense probably damaging 0.98
R7206:Tomm40 UTSW 7 19710936 missense probably benign 0.10
R7530:Tomm40 UTSW 7 19702904 missense possibly damaging 0.82
Z1176:Tomm40 UTSW 7 19703094 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGGTTCAAGCATCCAGGTC -3'
(R):5'- TAATCTCGTCAGGTCAGGCC -3'

Sequencing Primer
(F):5'- GCATCCAGGTCATCACTAAGTTG -3'
(R):5'- CCTGGTGTTTTGTTGGATCCC -3'
Posted On2014-06-23