Incidental Mutation 'R1842:Map4k1'
ID205816
Institutional Source Beutler Lab
Gene Symbol Map4k1
Ensembl Gene ENSMUSG00000037337
Gene Namemitogen-activated protein kinase kinase kinase kinase 1
SynonymsHpk1
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1842 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28982050-29003279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28987163 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 170 (L170P)
Ref Sequence ENSEMBL: ENSMUSP00000147189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085835] [ENSMUST00000207185] [ENSMUST00000208227]
Predicted Effect probably damaging
Transcript: ENSMUST00000085835
AA Change: L170P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082995
Gene: ENSMUSG00000037337
AA Change: L170P

DomainStartEndE-ValueType
S_TKc 17 274 3.58e-84 SMART
low complexity region 301 318 N/A INTRINSIC
low complexity region 373 383 N/A INTRINSIC
low complexity region 385 416 N/A INTRINSIC
low complexity region 426 446 N/A INTRINSIC
CNH 506 813 4.93e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207185
AA Change: L170P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208227
AA Change: L124P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have increased responses of B and T cells. Dendritic cells are also hyperresponsive to stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Map4k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Map4k1 APN 7 29001619 missense probably damaging 0.98
IGL01936:Map4k1 APN 7 28988607 missense possibly damaging 0.90
IGL02473:Map4k1 APN 7 28999872 missense probably damaging 1.00
IGL02934:Map4k1 APN 7 28994106 missense probably benign 0.00
IGL03180:Map4k1 APN 7 28988085 missense probably damaging 1.00
IGL03199:Map4k1 APN 7 28983417 missense probably damaging 1.00
IGL03493:Map4k1 APN 7 28984151 unclassified probably benign
R0333:Map4k1 UTSW 7 28999761 unclassified probably benign
R1296:Map4k1 UTSW 7 28998452 missense possibly damaging 0.96
R1305:Map4k1 UTSW 7 28995465 missense probably benign
R1519:Map4k1 UTSW 7 28991036 missense probably benign 0.00
R1711:Map4k1 UTSW 7 28989352 missense possibly damaging 0.80
R1851:Map4k1 UTSW 7 28999784 missense probably benign
R2042:Map4k1 UTSW 7 28984130 missense probably damaging 1.00
R2274:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R2275:Map4k1 UTSW 7 29001957 missense probably damaging 1.00
R4426:Map4k1 UTSW 7 28988595 missense probably damaging 1.00
R4568:Map4k1 UTSW 7 28986654 missense probably damaging 1.00
R4858:Map4k1 UTSW 7 28988770 missense probably damaging 1.00
R4903:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4964:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R4966:Map4k1 UTSW 7 28983002 missense probably benign 0.01
R5124:Map4k1 UTSW 7 28988832 missense probably damaging 1.00
R5778:Map4k1 UTSW 7 28994221 missense probably benign 0.37
R5786:Map4k1 UTSW 7 29000020 missense probably damaging 1.00
R6343:Map4k1 UTSW 7 29000290 missense possibly damaging 0.76
R6475:Map4k1 UTSW 7 28987022 missense probably damaging 1.00
R6702:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6703:Map4k1 UTSW 7 29002396 missense possibly damaging 0.86
R6856:Map4k1 UTSW 7 28986834 missense probably damaging 1.00
R6870:Map4k1 UTSW 7 29001671 critical splice donor site probably null
R6904:Map4k1 UTSW 7 28986802 missense probably damaging 1.00
R7081:Map4k1 UTSW 7 28991149 missense probably benign
R7572:Map4k1 UTSW 7 28987138 missense probably benign 0.01
R7868:Map4k1 UTSW 7 28999962 critical splice acceptor site probably null
R7951:Map4k1 UTSW 7 28999962 critical splice acceptor site probably null
R8034:Map4k1 UTSW 7 28988148 missense probably damaging 1.00
Z1177:Map4k1 UTSW 7 29000008 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGTCTCTGTCAGCCTCTA -3'
(R):5'- TCCTAAACACTAAGAGAAAGGGCC -3'

Sequencing Primer
(F):5'- TCTCCAGGGAGCCAACATC -3'
(R):5'- GCCAGAAAGAGACCTAGATAAGTG -3'
Posted On2014-06-23