Incidental Mutation 'R1842:Timm44'
ID205821
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Nametranslocase of inner mitochondrial membrane 44
SynonymsMimt44, 0710005E20Rik, Tim44, D8Ertd118e
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1842 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4259731-4275913 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4260510 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029] [ENSMUST00000011981] [ENSMUST00000053252] [ENSMUST00000208316] [ENSMUST00000208459]
Predicted Effect probably null
Transcript: ENSMUST00000003029
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000011981
SMART Domains Protein: ENSMUSP00000011981
Gene: ENSMUSG00000011837

DomainStartEndE-ValueType
Pfam:SnAPC_2_like 1 356 5.9e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053252
SMART Domains Protein: ENSMUSP00000057115
Gene: ENSMUSG00000048644

DomainStartEndE-ValueType
Pfam:Cortexin 7 82 7.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149827
Predicted Effect probably null
Transcript: ENSMUST00000160371
Predicted Effect probably benign
Transcript: ENSMUST00000208110
Predicted Effect probably benign
Transcript: ENSMUST00000208316
Predicted Effect probably benign
Transcript: ENSMUST00000208459
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4275888 utr 5 prime probably benign
IGL01768:Timm44 APN 8 4266860 missense probably benign 0.00
IGL02336:Timm44 APN 8 4267692 missense probably damaging 1.00
R0505:Timm44 UTSW 8 4260532 nonsense probably null
R0883:Timm44 UTSW 8 4266592 missense probably benign
R1965:Timm44 UTSW 8 4260603 missense possibly damaging 0.65
R2243:Timm44 UTSW 8 4267871 missense possibly damaging 0.91
R2318:Timm44 UTSW 8 4268307 missense probably benign 0.18
R2518:Timm44 UTSW 8 4266588 missense probably null 1.00
R4049:Timm44 UTSW 8 4260561 missense probably benign 0.00
R4489:Timm44 UTSW 8 4266654 missense possibly damaging 0.48
R4803:Timm44 UTSW 8 4267932 missense probably damaging 0.99
R5001:Timm44 UTSW 8 4275886 start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4275919 unclassified probably null
R5335:Timm44 UTSW 8 4266814 missense probably damaging 1.00
R5502:Timm44 UTSW 8 4269992 missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4266769 critical splice donor site probably null
R5700:Timm44 UTSW 8 4274171 missense probably damaging 1.00
R6004:Timm44 UTSW 8 4267747 missense probably benign 0.00
R6186:Timm44 UTSW 8 4266824 missense probably damaging 1.00
R6524:Timm44 UTSW 8 4267988 missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4267282 missense probably damaging 1.00
R6996:Timm44 UTSW 8 4266611 missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4267311 missense probably damaging 0.98
R7844:Timm44 UTSW 8 4269976 missense possibly damaging 0.71
R7927:Timm44 UTSW 8 4269976 missense possibly damaging 0.71
Z1088:Timm44 UTSW 8 4268004 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTTGTCCTGTGAAGACCG -3'
(R):5'- TTCATCTCCAGGGTTGTGAGC -3'

Sequencing Primer
(F):5'- TCCTGTGAAGACCGGGCAG -3'
(R):5'- ATCTCCAGGGTTGTGAGCATTGG -3'
Posted On2014-06-23