Incidental Mutation 'R1842:Slc18b1'
ID205827
Institutional Source Beutler Lab
Gene Symbol Slc18b1
Ensembl Gene ENSMUSG00000037455
Gene Namesolute carrier family 18, subfamily B, member 1
Synonyms1110021L09Rik
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1842 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23796986-23827968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23805993 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 152 (S152P)
Ref Sequence ENSEMBL: ENSMUSP00000112634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119597] [ENSMUST00000133289] [ENSMUST00000134170] [ENSMUST00000179321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119597
AA Change: S152P

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112634
Gene: ENSMUSG00000037455
AA Change: S152P

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 254 3.2e-26 PFAM
Pfam:MFS_1 237 454 7.4e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127841
AA Change: S6P
Predicted Effect probably benign
Transcript: ENSMUST00000133289
SMART Domains Protein: ENSMUSP00000121289
Gene: ENSMUSG00000037455

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134170
SMART Domains Protein: ENSMUSP00000116940
Gene: ENSMUSG00000037455

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 129 1.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179321
AA Change: S152P

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137431
Gene: ENSMUSG00000037455
AA Change: S152P

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 262 2.4e-26 PFAM
Pfam:LacY_symp 226 454 3.9e-8 PFAM
Pfam:MFS_1 241 456 4.9e-23 PFAM
Pfam:MFS_2 253 458 3.7e-9 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, which has high sequence similarity to rat, xenopus and zebrafish proteins. The protein function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Slc18b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Slc18b1 APN 10 23824761 critical splice donor site probably null
IGL01474:Slc18b1 APN 10 23803850 missense probably benign 0.35
IGL01788:Slc18b1 APN 10 23826001 missense probably damaging 0.96
IGL02660:Slc18b1 APN 10 23810952 splice site probably benign
IGL03049:Slc18b1 APN 10 23822946 missense probably benign 0.01
IGL03106:Slc18b1 APN 10 23826659 makesense probably null
R0440:Slc18b1 UTSW 10 23819078 missense probably benign 0.16
R0633:Slc18b1 UTSW 10 23806038 missense probably benign 0.00
R1086:Slc18b1 UTSW 10 23803795 missense probably benign 0.02
R1572:Slc18b1 UTSW 10 23798741 splice site probably benign
R2256:Slc18b1 UTSW 10 23810922 missense probably benign 0.25
R3423:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3424:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3425:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3765:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R3766:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R4063:Slc18b1 UTSW 10 23805981 missense probably benign 0.01
R4779:Slc18b1 UTSW 10 23820869 missense possibly damaging 0.71
R5714:Slc18b1 UTSW 10 23798766 missense probably benign 0.00
R5910:Slc18b1 UTSW 10 23824667 intron probably benign
R6084:Slc18b1 UTSW 10 23804212 missense probably benign 0.15
R6789:Slc18b1 UTSW 10 23816329 missense probably benign 0.02
R6868:Slc18b1 UTSW 10 23804234 missense possibly damaging 0.95
R6959:Slc18b1 UTSW 10 23826044 splice site probably null
R7632:Slc18b1 UTSW 10 23826182 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGATAGCTAAGCTGTCATGGC -3'
(R):5'- TGCTATTGGAACTGGAAATCACAG -3'

Sequencing Primer
(F):5'- AGGCTGGTCTTGAACTCACACAG -3'
(R):5'- TATTGGAACTGGAAATCACAGTGAAG -3'
Posted On2014-06-23