Incidental Mutation 'R1842:Efcab5'
ID 205830
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R1842 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 77089915-77188968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77134875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 538 (V538A)
Ref Sequence ENSEMBL: ENSMUSP00000118152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably benign
Transcript: ENSMUST00000108400
AA Change: V674A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: V674A

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130901
AA Change: V538A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: V538A

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148985
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
R8213:Efcab5 UTSW 11 77116071 missense probably damaging 1.00
R8690:Efcab5 UTSW 11 77103289 missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77121238 missense probably benign 0.03
R9310:Efcab5 UTSW 11 77113705 missense probably benign 0.23
R9324:Efcab5 UTSW 11 77113720 missense possibly damaging 0.95
R9404:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9405:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCATCTTCAAGAGGTGCAGTG -3'
(R):5'- AAGCCTGTGAACCAAAGCCG -3'

Sequencing Primer
(F):5'- CTCACAGTCAGCTATTGGATGGATC -3'
(R):5'- TGTGAACCAAAGCCGCAACATG -3'
Posted On 2014-06-23