Incidental Mutation 'R1842:Dcdc2a'
ID 205841
Institutional Source Beutler Lab
Gene Symbol Dcdc2a
Ensembl Gene ENSMUSG00000035910
Gene Name doublecortin domain containing 2a
Synonyms RU2, Dcdc2
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock # R1842 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 25056004-25210706 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25107602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 190 (L190S)
Ref Sequence ENSEMBL: ENSMUSP00000047641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036932] [ENSMUST00000069614]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036932
AA Change: L190S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047641
Gene: ENSMUSG00000035910
AA Change: L190S

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069614
AA Change: L190S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063650
Gene: ENSMUSG00000035910
AA Change: L190S

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
coiled coil region 409 437 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159129
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired short term object recognition, impaired visuo-spatial learning and memory and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Dcdc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Dcdc2a APN 13 25119329 missense probably benign 0.00
IGL01314:Dcdc2a APN 13 25102604 missense probably damaging 1.00
IGL02171:Dcdc2a APN 13 25056434 missense probably damaging 1.00
IGL02490:Dcdc2a APN 13 25107652 missense probably damaging 1.00
R0128:Dcdc2a UTSW 13 25187672 splice site probably benign
R0130:Dcdc2a UTSW 13 25187672 splice site probably benign
R0366:Dcdc2a UTSW 13 25056434 missense probably damaging 1.00
R0507:Dcdc2a UTSW 13 25102589 missense probably damaging 0.99
R0514:Dcdc2a UTSW 13 25119386 missense probably benign 0.04
R1055:Dcdc2a UTSW 13 25102610 missense probably damaging 0.99
R1170:Dcdc2a UTSW 13 25056307 missense probably benign 0.34
R1301:Dcdc2a UTSW 13 25102586 missense possibly damaging 0.93
R1514:Dcdc2a UTSW 13 25061254 missense probably benign 0.05
R2060:Dcdc2a UTSW 13 25107710 missense possibly damaging 0.59
R2121:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2122:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2900:Dcdc2a UTSW 13 25120498 missense probably benign 0.01
R3153:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R3154:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R4353:Dcdc2a UTSW 13 25056491 missense probably damaging 1.00
R4608:Dcdc2a UTSW 13 25061240 nonsense probably null
R5099:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R5128:Dcdc2a UTSW 13 25102529 missense probably damaging 1.00
R5181:Dcdc2a UTSW 13 25202364 missense possibly damaging 0.94
R5271:Dcdc2a UTSW 13 25187688 missense probably benign 0.35
R5869:Dcdc2a UTSW 13 25107730 missense probably benign 0.05
R6058:Dcdc2a UTSW 13 25056371 missense possibly damaging 0.82
R6146:Dcdc2a UTSW 13 25205457 missense probably benign 0.35
R6892:Dcdc2a UTSW 13 25056460 missense probably damaging 1.00
R6956:Dcdc2a UTSW 13 25119366 missense probably benign 0.02
R6972:Dcdc2a UTSW 13 25120389 intron probably benign
R6973:Dcdc2a UTSW 13 25120389 intron probably benign
R7097:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R7247:Dcdc2a UTSW 13 25102391 missense probably benign 0.00
R7390:Dcdc2a UTSW 13 25107617 missense possibly damaging 0.89
R7570:Dcdc2a UTSW 13 25119373 missense probably benign
R7636:Dcdc2a UTSW 13 25102622 missense probably damaging 1.00
R7644:Dcdc2a UTSW 13 25107691 missense probably damaging 1.00
R7898:Dcdc2a UTSW 13 25102378 missense possibly damaging 0.67
R8070:Dcdc2a UTSW 13 25202197 missense probably benign 0.00
R8183:Dcdc2a UTSW 13 25107650 missense possibly damaging 0.95
R8829:Dcdc2a UTSW 13 25110068 nonsense probably null
R8865:Dcdc2a UTSW 13 25202283 missense probably benign 0.00
R8867:Dcdc2a UTSW 13 25202283 missense probably benign 0.00
R8868:Dcdc2a UTSW 13 25202283 missense probably benign 0.00
R9290:Dcdc2a UTSW 13 25202330 missense probably benign
R9694:Dcdc2a UTSW 13 25102357 missense probably benign 0.27
R9760:Dcdc2a UTSW 13 25205460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGCAAAGACCATGCCC -3'
(R):5'- ACCCCTTTACACTGATGTCG -3'

Sequencing Primer
(F):5'- TGCCCAGATCTCCAGTATGAAGG -3'
(R):5'- TGATGTCGCCCCACAAGTC -3'
Posted On 2014-06-23