Incidental Mutation 'R1842:Pacs1'
ID205857
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Namephosphofurin acidic cluster sorting protein 1
Synonyms
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1842 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5133688-5273119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5155884 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 288 (E288G)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: E288G

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: E288G

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Kdm5d C T Y: 927,798 S716L probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGGTCAGTTTCCTCCGAGTC -3'
(R):5'- CTGGGAAATGTGTTCATGCG -3'

Sequencing Primer
(F):5'- GAGTCTTCTTTACTTTCCGAAGATC -3'
(R):5'- TCATGCGAGATAAGCTTAGAGATCCC -3'
Posted On2014-06-23