Incidental Mutation 'R1854:Lamc1'
ID205873
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Namelaminin, gamma 1
Synonymslaminin B2, Lamb2
MMRRC Submission 039878-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1854 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153218922-153332786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153249872 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 552 (Y552H)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
Predicted Effect probably damaging
Transcript: ENSMUST00000027752
AA Change: Y552H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: Y552H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159251
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,707,780 R43K possibly damaging Het
Acp1 A G 12: 30,897,805 I78T possibly damaging Het
Afap1l1 G T 18: 61,743,294 D417E probably benign Het
Agap2 G A 10: 127,080,516 V299I unknown Het
Ahnak C T 19: 9,013,832 A4160V possibly damaging Het
Anapc1 T C 2: 128,675,890 E278G probably damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atg2a A G 19: 6,252,431 E928G probably benign Het
Atp2b2 A C 6: 113,842,283 N16K probably damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
Bfsp2 C T 9: 103,449,831 G236S probably benign Het
Ccar1 A T 10: 62,764,517 I545N probably damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cdc42bpg A T 19: 6,320,807 H1310L possibly damaging Het
Ces1h T C 8: 93,358,822 K339E probably benign Het
Cit A G 5: 115,873,901 Y189C probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Cntrl A G 2: 35,122,684 D278G probably damaging Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Col6a1 T G 10: 76,721,949 Y151S probably damaging Het
Col6a2 T A 10: 76,614,812 Q95L probably damaging Het
Cpd G T 11: 76,786,338 P1185Q probably damaging Het
Cycs T A 6: 50,565,329 I76F possibly damaging Het
Cyp4f16 T A 17: 32,537,099 I34N probably damaging Het
Ddx1 A C 12: 13,229,331 S436A probably benign Het
Defa30 A G 8: 21,135,484 Y88C probably damaging Het
Dhx30 G A 9: 110,088,672 L317F probably damaging Het
Dll3 C A 7: 28,296,410 G322V probably damaging Het
Dnah10 G A 5: 124,804,689 D2843N probably damaging Het
Dnaja3 C T 16: 4,697,269 T266I probably damaging Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
E030025P04Rik A G 11: 109,143,918 V48A unknown Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Eri3 G A 4: 117,649,365 G297D probably benign Het
Esp34 A G 17: 38,559,533 E38G possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Frzb A G 2: 80,446,380 V154A possibly damaging Het
Fsip2 G T 2: 82,993,257 A6445S possibly damaging Het
Gm11938 G A 11: 99,603,017 T84I possibly damaging Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Gpa33 A G 1: 166,165,190 I291V probably benign Het
Gpr158 A G 2: 21,369,124 Y290C probably damaging Het
Gpsm1 G T 2: 26,344,713 G84W probably damaging Het
Hormad1 A G 3: 95,580,006 N267S probably benign Het
Htr2a A T 14: 74,705,753 I258F probably damaging Het
Htra4 T C 8: 25,033,581 T323A probably damaging Het
Ift140 T A 17: 25,035,839 F162Y probably benign Het
Islr2 T C 9: 58,199,816 T54A probably damaging Het
Kcna4 T G 2: 107,296,484 V521G probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Kif6 G T 17: 49,901,771 A740S probably benign Het
Lad1 T A 1: 135,827,730 V248E probably damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Maats1 T C 16: 38,324,297 probably null Het
Mctp1 A T 13: 76,825,741 T706S probably damaging Het
Med12l A G 3: 59,260,772 Y1541C probably damaging Het
Mnx1 C T 5: 29,477,782 S165N unknown Het
Morn3 A T 5: 123,046,629 probably null Het
Nalcn C T 14: 123,460,412 R484Q probably damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Olfr30 G A 11: 58,455,431 R173W probably damaging Het
Olfr339 C T 2: 36,421,874 H159Y probably damaging Het
Pcdhb5 T C 18: 37,322,340 V591A possibly damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Phactr3 C A 2: 178,283,147 L292M probably damaging Het
Phf21b T A 15: 84,854,762 I21F probably benign Het
Pign A G 1: 105,554,498 V791A probably damaging Het
Pitpna A G 11: 75,609,103 probably null Het
Piwil1 G T 5: 128,747,839 E534* probably null Het
Plcz1 T A 6: 139,993,049 I526F probably benign Het
Pms2 A T 5: 143,925,896 K607I probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Polq C T 16: 37,062,109 T1545I probably benign Het
Psd4 G A 2: 24,397,456 E467K probably benign Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Pzp T C 6: 128,502,225 Y655C probably damaging Het
Qrsl1 C T 10: 43,894,545 G117E probably damaging Het
Rad54b G A 4: 11,601,669 C408Y probably damaging Het
Ralb T A 1: 119,476,067 Q110L possibly damaging Het
Rrm2 A G 12: 24,713,152 K218E probably damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc17a8 A T 10: 89,606,765 C69S unknown Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc38a11 A T 2: 65,363,516 probably null Het
Smarcal1 G A 1: 72,586,099 G135D possibly damaging Het
Snrnp70 T A 7: 45,377,220 R242* probably null Het
St3gal5 T C 6: 72,132,093 L55P probably damaging Het
Sulf1 A G 1: 12,838,437 N558S probably benign Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tas2r113 T A 6: 132,893,329 Y107N probably damaging Het
Tcf7 A G 11: 52,257,064 V187A probably benign Het
Tdrd9 G A 12: 112,044,812 G1152R probably damaging Het
Tfpi A G 2: 84,458,107 Y9H probably benign Het
Tnk2 G A 16: 32,680,142 V758I probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trip12 T A 1: 84,728,145 N655Y probably damaging Het
Ttn A G 2: 76,751,429 V23040A probably damaging Het
Tulp2 T A 7: 45,517,943 N188K probably damaging Het
Ube2c C T 2: 164,771,362 H67Y probably damaging Het
Unc80 C A 1: 66,631,414 P1899T possibly damaging Het
Usp34 C T 11: 23,426,153 A1879V probably benign Het
Vmn2r118 G A 17: 55,611,556 S112L possibly damaging Het
Wdfy3 A T 5: 101,888,186 V2122E probably benign Het
Zcchc4 A G 5: 52,815,826 Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zdhhc25 A T 15: 88,600,486 H8L probably benign Het
Zfp455 A T 13: 67,207,817 H383L probably damaging Het
Zfp663 A G 2: 165,353,291 I336T probably benign Het
Zfp738 T A 13: 67,670,357 H505L probably damaging Het
Zfp84 T G 7: 29,775,371 F23V possibly damaging Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153240495 missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153251134 missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153221573 missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153247082 missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153240433 missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153247042 missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153249853 missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153250661 missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153247055 missense probably benign 0.00
IGL03069:Lamc1 APN 1 153239381 missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153332274 missense probably benign 0.00
IGL03166:Lamc1 APN 1 153332301 missense probably benign 0.01
IGL03285:Lamc1 APN 1 153227685 missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153262646 missense probably damaging 1.00
pride UTSW 1 153247284 missense probably benign 0.01
PIT4280001:Lamc1 UTSW 1 153243471 missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153262583 missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153241868 unclassified probably benign
R0078:Lamc1 UTSW 1 153229190 missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153262607 missense probably benign 0.00
R0282:Lamc1 UTSW 1 153255312 missense probably benign
R0374:Lamc1 UTSW 1 153251065 splice site probably benign
R0494:Lamc1 UTSW 1 153246936 critical splice donor site probably null
R0502:Lamc1 UTSW 1 153246932 splice site probably benign
R0755:Lamc1 UTSW 1 153247450 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0792:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0892:Lamc1 UTSW 1 153332254 missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153332274 missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153221646 frame shift probably null
R0961:Lamc1 UTSW 1 153221700 missense probably benign 0.03
R0963:Lamc1 UTSW 1 153243386 missense probably benign
R1127:Lamc1 UTSW 1 153250459 missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153247231 splice site probably benign
R1175:Lamc1 UTSW 1 153247231 splice site probably benign
R1449:Lamc1 UTSW 1 153250495 missense probably benign
R1481:Lamc1 UTSW 1 153221634 missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153242743 missense probably benign 0.34
R1583:Lamc1 UTSW 1 153243478 critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153258072 splice site probably benign
R1652:Lamc1 UTSW 1 153249646 missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153247249 missense probably benign 0.04
R2018:Lamc1 UTSW 1 153242632 missense probably benign 0.07
R2170:Lamc1 UTSW 1 153249142 missense probably benign 0.07
R2410:Lamc1 UTSW 1 153247395 missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153226415 missense probably benign 0.04
R3615:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153255205 missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153262708 splice site probably null
R4285:Lamc1 UTSW 1 153234552 missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153221528 missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153247269 missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153242696 missense probably benign 0.04
R4649:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153229100 missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153233564 missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153251970 missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153247284 missense probably benign 0.01
R6233:Lamc1 UTSW 1 153223666 missense probably benign
R6431:Lamc1 UTSW 1 153221671 missense probably benign 0.21
R6636:Lamc1 UTSW 1 153241975 missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153262492 missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153226454 missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153234650 missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153249076 missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153332265 missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153243275 missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153243232 missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153240454 missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153249060 missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153247268 missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153221612 missense probably benign 0.04
R8207:Lamc1 UTSW 1 153250522 missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153247327 missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153223754 missense probably benign 0.04
R8315:Lamc1 UTSW 1 153243421 missense probably benign 0.00
R8417:Lamc1 UTSW 1 153230769 missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153233542 missense probably benign 0.31
R8827:Lamc1 UTSW 1 153221678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGAGCACAAGGTCCTCTG -3'
(R):5'- AGTGCAGTTCATACACTTTGTGGG -3'

Sequencing Primer
(F):5'- TCGTCTGTCCACTCGGAAG -3'
(R):5'- CATACACTTTGTGGGGCCTG -3'
Posted On2014-06-23