Incidental Mutation 'R0113:Ces1f'
ID20588
Institutional Source Beutler Lab
Gene Symbol Ces1f
Ensembl Gene ENSMUSG00000031725
Gene Namecarboxylesterase 1F
SynonymsTGH-2, CesML1
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0113 (G1)
Quality Score199
Status Validated (trace)
Chromosome8
Chromosomal Location93256236-93279747 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 93279699 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000116525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034178] [ENSMUST00000140026]
Predicted Effect probably null
Transcript: ENSMUST00000034178
AA Change: M1K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034178
Gene: ENSMUSG00000031725
AA Change: M1K

DomainStartEndE-ValueType
Pfam:COesterase 1 545 2.5e-166 PFAM
Pfam:Abhydrolase_3 136 244 4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133879
Predicted Effect probably null
Transcript: ENSMUST00000140026
AA Change: M1K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116525
Gene: ENSMUSG00000031725
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A probably benign Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in Ces1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ces1f APN 8 93267992 missense probably benign
IGL01143:Ces1f APN 8 93271830 critical splice donor site probably null
IGL01571:Ces1f APN 8 93258368 missense probably benign 0.00
IGL01731:Ces1f APN 8 93267320 missense possibly damaging 0.73
IGL01733:Ces1f APN 8 93270014 missense probably damaging 1.00
IGL02124:Ces1f APN 8 93265860 missense possibly damaging 0.54
IGL03058:Ces1f APN 8 93269972 critical splice donor site probably null
IGL03124:Ces1f APN 8 93275384 missense probably benign
3-1:Ces1f UTSW 8 93275431 missense probably benign 0.29
G5030:Ces1f UTSW 8 93274219 missense probably benign 0.03
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0201:Ces1f UTSW 8 93267329 missense probably null 0.01
R0306:Ces1f UTSW 8 93276544 splice site probably benign
R0317:Ces1f UTSW 8 93263391 missense probably benign 0.05
R0558:Ces1f UTSW 8 93275389 missense probably benign
R0791:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R0833:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R0836:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R1087:Ces1f UTSW 8 93258295 missense probably damaging 1.00
R1118:Ces1f UTSW 8 93267242 splice site probably benign
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1183:Ces1f UTSW 8 93268005 missense probably benign 0.01
R1371:Ces1f UTSW 8 93279649 missense probably damaging 0.98
R1480:Ces1f UTSW 8 93274154 missense probably benign 0.07
R1522:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R1681:Ces1f UTSW 8 93275414 missense probably benign 0.00
R1865:Ces1f UTSW 8 93274265 splice site probably benign
R2437:Ces1f UTSW 8 93270139 splice site probably null
R3038:Ces1f UTSW 8 93256598 missense probably damaging 1.00
R4199:Ces1f UTSW 8 93256889 missense probably benign 0.00
R4406:Ces1f UTSW 8 93263322 missense probably benign
R5385:Ces1f UTSW 8 93265760 nonsense probably null
R5450:Ces1f UTSW 8 93265795 missense probably benign 0.04
R5627:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R6182:Ces1f UTSW 8 93256496 missense probably benign 0.43
R6256:Ces1f UTSW 8 93265794 missense probably damaging 1.00
R6379:Ces1f UTSW 8 93279651 missense probably benign
R6443:Ces1f UTSW 8 93275365 missense probably benign 0.00
R6967:Ces1f UTSW 8 93267997 missense probably benign 0.00
R7158:Ces1f UTSW 8 93268016 missense probably benign 0.00
R7323:Ces1f UTSW 8 93271844 missense probably damaging 1.00
R7654:Ces1f UTSW 8 93271934 missense probably benign 0.00
R7810:Ces1f UTSW 8 93256918 missense probably damaging 1.00
R7812:Ces1f UTSW 8 93258310 missense probably benign 0.00
R7864:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7947:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7999:Ces1f UTSW 8 93262995 missense possibly damaging 0.77
X0026:Ces1f UTSW 8 93270056 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTTGATCTCAGAGTGTCCTGCACC -3'
(R):5'- ACTGCCTGGAGGTATTTGCTTGAC -3'

Sequencing Primer
(F):5'- TGTAGGCCACTTAGAGGCAAATC -3'
(R):5'- ACCCCTTCCTTGTGGATCAG -3'
Posted On2013-04-11