Mutagenetix > Incidental Mutation

Incidental Mutation 'R1854:Col24a1'

205894

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

039878-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1854 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 145459140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1033 (G1033D)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably damaging
Transcript: ENSMUST00000029848
AA Change: G1033D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: G1033D

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Meta Mutation Damage Score

0.9497

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	T	16: 88,707,780	R43K	possibly damaging	Het
Acp1	A	G	12: 30,897,805	I78T	possibly damaging	Het
Afap1l1	G	T	18: 61,743,294	D417E	probably benign	Het
Agap2	G	A	10: 127,080,516	V299I	unknown	Het
Ahnak	C	T	19: 9,013,832	A4160V	possibly damaging	Het
Anapc1	T	C	2: 128,675,890	E278G	probably damaging	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
Atg2a	A	G	19: 6,252,431	E928G	probably benign	Het
Atp2b2	A	C	6: 113,842,283	N16K	probably damaging	Het
Atp6ap1l	T	C	13: 90,883,588	E325G	probably damaging	Het
Bfsp2	C	T	9: 103,449,831	G236S	probably benign	Het
Ccar1	A	T	10: 62,764,517	I545N	probably damaging	Het
Ccser2	A	G	14: 36,918,591	C11R	possibly damaging	Het
Cdc42bpg	A	T	19: 6,320,807	H1310L	possibly damaging	Het
Ces1h	T	C	8: 93,358,822	K339E	probably benign	Het
Cit	A	G	5: 115,873,901	Y189C	probably damaging	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Cntrl	A	G	2: 35,122,684	D278G	probably damaging	Het
Col6a1	T	G	10: 76,721,949	Y151S	probably damaging	Het
Col6a2	T	A	10: 76,614,812	Q95L	probably damaging	Het
Cpd	G	T	11: 76,786,338	P1185Q	probably damaging	Het
Cycs	T	A	6: 50,565,329	I76F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,099	I34N	probably damaging	Het
Ddx1	A	C	12: 13,229,331	S436A	probably benign	Het
Defa30	A	G	8: 21,135,484	Y88C	probably damaging	Het
Dhx30	G	A	9: 110,088,672	L317F	probably damaging	Het
Dll3	C	A	7: 28,296,410	G322V	probably damaging	Het
Dnah10	G	A	5: 124,804,689	D2843N	probably damaging	Het
Dnaja3	C	T	16: 4,697,269	T266I	probably damaging	Het
Dpp9	T	C	17: 56,202,885	I314V	probably benign	Het
E030025P04Rik	A	G	11: 109,143,918	V48A	unknown	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Eri3	G	A	4: 117,649,365	G297D	probably benign	Het
Esp34	A	G	17: 38,559,533	E38G	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Frzb	A	G	2: 80,446,380	V154A	possibly damaging	Het
Fsip2	G	T	2: 82,993,257	A6445S	possibly damaging	Het
Gm11938	G	A	11: 99,603,017	T84I	possibly damaging	Het
Gm4787	T	A	12: 81,378,334	H350L	probably damaging	Het
Gpa33	A	G	1: 166,165,190	I291V	probably benign	Het
Gpr158	A	G	2: 21,369,124	Y290C	probably damaging	Het
Gpsm1	G	T	2: 26,344,713	G84W	probably damaging	Het
Hormad1	A	G	3: 95,580,006	N267S	probably benign	Het
Htr2a	A	T	14: 74,705,753	I258F	probably damaging	Het
Htra4	T	C	8: 25,033,581	T323A	probably damaging	Het
Ift140	T	A	17: 25,035,839	F162Y	probably benign	Het
Islr2	T	C	9: 58,199,816	T54A	probably damaging	Het
Kcna4	T	G	2: 107,296,484	V521G	probably damaging	Het
Kdr	C	T	5: 75,952,905	G768S	possibly damaging	Het
Kif6	G	T	17: 49,901,771	A740S	probably benign	Het
Lad1	T	A	1: 135,827,730	V248E	probably damaging	Het
Lamb1	T	G	12: 31,318,272	C1134G	probably damaging	Het
Lamc1	A	G	1: 153,249,872	Y552H	probably damaging	Het
Maats1	T	C	16: 38,324,297		probably null	Het
Mctp1	A	T	13: 76,825,741	T706S	probably damaging	Het
Med12l	A	G	3: 59,260,772	Y1541C	probably damaging	Het
Mnx1	C	T	5: 29,477,782	S165N	unknown	Het
Morn3	A	T	5: 123,046,629		probably null	Het
Nalcn	C	T	14: 123,460,412	R484Q	probably damaging	Het
Nr4a1	T	C	15: 101,271,764	I305T	probably benign	Het
Olfr30	G	A	11: 58,455,431	R173W	probably damaging	Het
Olfr339	C	T	2: 36,421,874	H159Y	probably damaging	Het
Pcdhb5	T	C	18: 37,322,340	V591A	possibly damaging	Het
Pdia3	T	C	2: 121,431,663	I205T	probably benign	Het
Pdia4	A	T	6: 47,813,227	D26E	unknown	Het
Phactr3	C	A	2: 178,283,147	L292M	probably damaging	Het
Phf21b	T	A	15: 84,854,762	I21F	probably benign	Het
Pign	A	G	1: 105,554,498	V791A	probably damaging	Het
Pitpna	A	G	11: 75,609,103		probably null	Het
Piwil1	G	T	5: 128,747,839	E534*	probably null	Het
Plcz1	T	A	6: 139,993,049	I526F	probably benign	Het
Pms2	A	T	5: 143,925,896	K607I	probably benign	Het
Pnn	T	A	12: 59,071,613	N327K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Polq	C	T	16: 37,062,109	T1545I	probably benign	Het
Psd4	G	A	2: 24,397,456	E467K	probably benign	Het
Pstpip2	T	A	18: 77,871,799	L198Q	probably damaging	Het
Pzp	T	C	6: 128,502,225	Y655C	probably damaging	Het
Qrsl1	C	T	10: 43,894,545	G117E	probably damaging	Het
Rad54b	G	A	4: 11,601,669	C408Y	probably damaging	Het
Ralb	T	A	1: 119,476,067	Q110L	possibly damaging	Het
Rrm2	A	G	12: 24,713,152	K218E	probably damaging	Het
Siglece	A	G	7: 43,659,936	F66S	probably benign	Het
Slc17a8	A	T	10: 89,606,765	C69S	unknown	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc38a11	A	T	2: 65,363,516		probably null	Het
Smarcal1	G	A	1: 72,586,099	G135D	possibly damaging	Het
Snrnp70	T	A	7: 45,377,220	R242*	probably null	Het
St3gal5	T	C	6: 72,132,093	L55P	probably damaging	Het
Sulf1	A	G	1: 12,838,437	N558S	probably benign	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tas2r113	T	A	6: 132,893,329	Y107N	probably damaging	Het
Tcf7	A	G	11: 52,257,064	V187A	probably benign	Het
Tdrd9	G	A	12: 112,044,812	G1152R	probably damaging	Het
Tfpi	A	G	2: 84,458,107	Y9H	probably benign	Het
Tnk2	G	A	16: 32,680,142	V758I	probably damaging	Het
Trim72	A	G	7: 128,009,082	I251V	probably benign	Het
Trip12	T	A	1: 84,728,145	N655Y	probably damaging	Het
Ttn	A	G	2: 76,751,429	V23040A	probably damaging	Het
Tulp2	T	A	7: 45,517,943	N188K	probably damaging	Het
Ube2c	C	T	2: 164,771,362	H67Y	probably damaging	Het
Unc80	C	A	1: 66,631,414	P1899T	possibly damaging	Het
Usp34	C	T	11: 23,426,153	A1879V	probably benign	Het
Vmn2r118	G	A	17: 55,611,556	S112L	possibly damaging	Het
Wdfy3	A	T	5: 101,888,186	V2122E	probably benign	Het
Zcchc4	A	G	5: 52,815,826	Y344C	probably damaging	Het
Zdbf2	GAAAAA	GAAAAAA	1: 63,305,542		probably null	Het
Zdhhc25	A	T	15: 88,600,486	H8L	probably benign	Het
Zfp455	A	T	13: 67,207,817	H383L	probably damaging	Het
Zfp663	A	G	2: 165,353,291	I336T	probably benign	Het
Zfp738	T	A	13: 67,670,357	H505L	probably damaging	Het
Zfp84	T	G	7: 29,775,371	F23V	possibly damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACAATGATGAGAGTTTGGGG -3'
(R):5'- GCCTTCAAGATGGCGTTTGTC -3'

Sequencing Primer
(F):5'- GTGAAGCTGTTTCTGATATTTGAAC -3'
(R):5'- CAAGCACTTGGATATAGTGGCTC -3'

Posted On

2014-06-23