Mutagenetix > Incidental Mutation

Incidental Mutation 'R1854:Cit'

205907

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

039878-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R1854 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115873901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 189 (Y189C)

Ref Sequence

ENSEMBL: ENSMUSP00000115802 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000137952] [ENSMUST00000141101] [ENSMUST00000148245]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051704
AA Change: Y189C

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: Y189C

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102560
AA Change: Y189C

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: Y189C

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112008
AA Change: Y189C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: Y189C

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137952

SMART Domains

Protein: ENSMUSP00000122745
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
Pfam:Pkinase	97	175	9.4e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000141101
AA Change: Y189C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: Y189C

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147330

Predicted Effect

probably benign
Transcript: ENSMUST00000148245

SMART Domains

Protein: ENSMUSP00000119769
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
Pfam:Pkinase	97	181	7.6e-12	PFAM
Pfam:Pkinase_Tyr	97	181	9.5e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201056

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	T	16: 88,707,780	R43K	possibly damaging	Het
Acp1	A	G	12: 30,897,805	I78T	possibly damaging	Het
Afap1l1	G	T	18: 61,743,294	D417E	probably benign	Het
Agap2	G	A	10: 127,080,516	V299I	unknown	Het
Ahnak	C	T	19: 9,013,832	A4160V	possibly damaging	Het
Anapc1	T	C	2: 128,675,890	E278G	probably damaging	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
Atg2a	A	G	19: 6,252,431	E928G	probably benign	Het
Atp2b2	A	C	6: 113,842,283	N16K	probably damaging	Het
Atp6ap1l	T	C	13: 90,883,588	E325G	probably damaging	Het
Bfsp2	C	T	9: 103,449,831	G236S	probably benign	Het
Ccar1	A	T	10: 62,764,517	I545N	probably damaging	Het
Ccser2	A	G	14: 36,918,591	C11R	possibly damaging	Het
Cdc42bpg	A	T	19: 6,320,807	H1310L	possibly damaging	Het
Ces1h	T	C	8: 93,358,822	K339E	probably benign	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Cntrl	A	G	2: 35,122,684	D278G	probably damaging	Het
Col24a1	G	A	3: 145,459,140	G1033D	probably damaging	Het
Col6a1	T	G	10: 76,721,949	Y151S	probably damaging	Het
Col6a2	T	A	10: 76,614,812	Q95L	probably damaging	Het
Cpd	G	T	11: 76,786,338	P1185Q	probably damaging	Het
Cycs	T	A	6: 50,565,329	I76F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,099	I34N	probably damaging	Het
Ddx1	A	C	12: 13,229,331	S436A	probably benign	Het
Defa30	A	G	8: 21,135,484	Y88C	probably damaging	Het
Dhx30	G	A	9: 110,088,672	L317F	probably damaging	Het
Dll3	C	A	7: 28,296,410	G322V	probably damaging	Het
Dnah10	G	A	5: 124,804,689	D2843N	probably damaging	Het
Dnaja3	C	T	16: 4,697,269	T266I	probably damaging	Het
Dpp9	T	C	17: 56,202,885	I314V	probably benign	Het
E030025P04Rik	A	G	11: 109,143,918	V48A	unknown	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Eri3	G	A	4: 117,649,365	G297D	probably benign	Het
Esp34	A	G	17: 38,559,533	E38G	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Frzb	A	G	2: 80,446,380	V154A	possibly damaging	Het
Fsip2	G	T	2: 82,993,257	A6445S	possibly damaging	Het
Gm11938	G	A	11: 99,603,017	T84I	possibly damaging	Het
Gm4787	T	A	12: 81,378,334	H350L	probably damaging	Het
Gpa33	A	G	1: 166,165,190	I291V	probably benign	Het
Gpr158	A	G	2: 21,369,124	Y290C	probably damaging	Het
Gpsm1	G	T	2: 26,344,713	G84W	probably damaging	Het
Hormad1	A	G	3: 95,580,006	N267S	probably benign	Het
Htr2a	A	T	14: 74,705,753	I258F	probably damaging	Het
Htra4	T	C	8: 25,033,581	T323A	probably damaging	Het
Ift140	T	A	17: 25,035,839	F162Y	probably benign	Het
Islr2	T	C	9: 58,199,816	T54A	probably damaging	Het
Kcna4	T	G	2: 107,296,484	V521G	probably damaging	Het
Kdr	C	T	5: 75,952,905	G768S	possibly damaging	Het
Kif6	G	T	17: 49,901,771	A740S	probably benign	Het
Lad1	T	A	1: 135,827,730	V248E	probably damaging	Het
Lamb1	T	G	12: 31,318,272	C1134G	probably damaging	Het
Lamc1	A	G	1: 153,249,872	Y552H	probably damaging	Het
Maats1	T	C	16: 38,324,297		probably null	Het
Mctp1	A	T	13: 76,825,741	T706S	probably damaging	Het
Med12l	A	G	3: 59,260,772	Y1541C	probably damaging	Het
Mnx1	C	T	5: 29,477,782	S165N	unknown	Het
Morn3	A	T	5: 123,046,629		probably null	Het
Nalcn	C	T	14: 123,460,412	R484Q	probably damaging	Het
Nr4a1	T	C	15: 101,271,764	I305T	probably benign	Het
Olfr30	G	A	11: 58,455,431	R173W	probably damaging	Het
Olfr339	C	T	2: 36,421,874	H159Y	probably damaging	Het
Pcdhb5	T	C	18: 37,322,340	V591A	possibly damaging	Het
Pdia3	T	C	2: 121,431,663	I205T	probably benign	Het
Pdia4	A	T	6: 47,813,227	D26E	unknown	Het
Phactr3	C	A	2: 178,283,147	L292M	probably damaging	Het
Phf21b	T	A	15: 84,854,762	I21F	probably benign	Het
Pign	A	G	1: 105,554,498	V791A	probably damaging	Het
Pitpna	A	G	11: 75,609,103		probably null	Het
Piwil1	G	T	5: 128,747,839	E534*	probably null	Het
Plcz1	T	A	6: 139,993,049	I526F	probably benign	Het
Pms2	A	T	5: 143,925,896	K607I	probably benign	Het
Pnn	T	A	12: 59,071,613	N327K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Polq	C	T	16: 37,062,109	T1545I	probably benign	Het
Psd4	G	A	2: 24,397,456	E467K	probably benign	Het
Pstpip2	T	A	18: 77,871,799	L198Q	probably damaging	Het
Pzp	T	C	6: 128,502,225	Y655C	probably damaging	Het
Qrsl1	C	T	10: 43,894,545	G117E	probably damaging	Het
Rad54b	G	A	4: 11,601,669	C408Y	probably damaging	Het
Ralb	T	A	1: 119,476,067	Q110L	possibly damaging	Het
Rrm2	A	G	12: 24,713,152	K218E	probably damaging	Het
Siglece	A	G	7: 43,659,936	F66S	probably benign	Het
Slc17a8	A	T	10: 89,606,765	C69S	unknown	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc38a11	A	T	2: 65,363,516		probably null	Het
Smarcal1	G	A	1: 72,586,099	G135D	possibly damaging	Het
Snrnp70	T	A	7: 45,377,220	R242*	probably null	Het
St3gal5	T	C	6: 72,132,093	L55P	probably damaging	Het
Sulf1	A	G	1: 12,838,437	N558S	probably benign	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tas2r113	T	A	6: 132,893,329	Y107N	probably damaging	Het
Tcf7	A	G	11: 52,257,064	V187A	probably benign	Het
Tdrd9	G	A	12: 112,044,812	G1152R	probably damaging	Het
Tfpi	A	G	2: 84,458,107	Y9H	probably benign	Het
Tnk2	G	A	16: 32,680,142	V758I	probably damaging	Het
Trim72	A	G	7: 128,009,082	I251V	probably benign	Het
Trip12	T	A	1: 84,728,145	N655Y	probably damaging	Het
Ttn	A	G	2: 76,751,429	V23040A	probably damaging	Het
Tulp2	T	A	7: 45,517,943	N188K	probably damaging	Het
Ube2c	C	T	2: 164,771,362	H67Y	probably damaging	Het
Unc80	C	A	1: 66,631,414	P1899T	possibly damaging	Het
Usp34	C	T	11: 23,426,153	A1879V	probably benign	Het
Vmn2r118	G	A	17: 55,611,556	S112L	possibly damaging	Het
Wdfy3	A	T	5: 101,888,186	V2122E	probably benign	Het
Zcchc4	A	G	5: 52,815,826	Y344C	probably damaging	Het
Zdbf2	GAAAAA	GAAAAAA	1: 63,305,542		probably null	Het
Zdhhc25	A	T	15: 88,600,486	H8L	probably benign	Het
Zfp455	A	T	13: 67,207,817	H383L	probably damaging	Het
Zfp663	A	G	2: 165,353,291	I336T	probably benign	Het
Zfp738	T	A	13: 67,670,357	H505L	probably damaging	Het
Zfp84	T	G	7: 29,775,371	F23V	possibly damaging	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTCTGAGGATCCGTCTC -3'
(R):5'- GAGTTGTCAGCCAATCACAGG -3'

Sequencing Primer
(F):5'- GTCTCGCACATGGACATTGC -3'
(R):5'- CCAATCACAGGGTGGCTAAAACTAG -3'

Posted On

2014-06-23