Incidental Mutation 'R1854:Islr2'
ID205933
Institutional Source Beutler Lab
Gene Symbol Islr2
Ensembl Gene ENSMUSG00000051243
Gene Nameimmunoglobulin superfamily containing leucine-rich repeat 2
SynonymsLinx, mbu-3, B930052A04Rik
MMRRC Submission 039878-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1854 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58196297-58204319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58199816 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 54 (T54A)
Ref Sequence ENSEMBL: ENSMUSP00000150877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114144] [ENSMUST00000163200] [ENSMUST00000163897] [ENSMUST00000165276] [ENSMUST00000170421] [ENSMUST00000214647] [ENSMUST00000214649] [ENSMUST00000215950] [ENSMUST00000216231] [ENSMUST00000216297] [ENSMUST00000217050] [ENSMUST00000217427] [ENSMUST00000217512] [ENSMUST00000217578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114144
AA Change: T54A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109781
Gene: ENSMUSG00000051243
AA Change: T54A

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163200
AA Change: T98A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130879
Gene: ENSMUSG00000051243
AA Change: T98A

DomainStartEndE-ValueType
LRRNT 63 99 1.1e-1 SMART
LRR 93 117 8.24e0 SMART
LRR 142 165 1.91e1 SMART
LRR 166 189 3.07e-1 SMART
LRR_TYP 190 213 1.58e-3 SMART
LRRCT 225 275 2.36e-12 SMART
IG 289 418 2.99e-2 SMART
low complexity region 554 579 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
low complexity region 706 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163897
AA Change: T54A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130322
Gene: ENSMUSG00000051243
AA Change: T54A

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165276
AA Change: T54A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129328
Gene: ENSMUSG00000051243
AA Change: T54A

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170421
AA Change: T54A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127228
Gene: ENSMUSG00000051243
AA Change: T54A

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213495
Predicted Effect possibly damaging
Transcript: ENSMUST00000214647
AA Change: T54A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000214649
AA Change: T54A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215950
AA Change: T54A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216231
AA Change: T54A

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216297
AA Change: T54A

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216359
Predicted Effect possibly damaging
Transcript: ENSMUST00000217050
AA Change: T54A

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217158
Predicted Effect probably benign
Transcript: ENSMUST00000217427
AA Change: T54A

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000217512
AA Change: T54A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, absent tail pinch response, and defective peroneal and tibial nerve morphology and branch extension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,707,780 R43K possibly damaging Het
Acp1 A G 12: 30,897,805 I78T possibly damaging Het
Afap1l1 G T 18: 61,743,294 D417E probably benign Het
Agap2 G A 10: 127,080,516 V299I unknown Het
Ahnak C T 19: 9,013,832 A4160V possibly damaging Het
Anapc1 T C 2: 128,675,890 E278G probably damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atg2a A G 19: 6,252,431 E928G probably benign Het
Atp2b2 A C 6: 113,842,283 N16K probably damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
Bfsp2 C T 9: 103,449,831 G236S probably benign Het
Ccar1 A T 10: 62,764,517 I545N probably damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cdc42bpg A T 19: 6,320,807 H1310L possibly damaging Het
Ces1h T C 8: 93,358,822 K339E probably benign Het
Cit A G 5: 115,873,901 Y189C probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Cntrl A G 2: 35,122,684 D278G probably damaging Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Col6a1 T G 10: 76,721,949 Y151S probably damaging Het
Col6a2 T A 10: 76,614,812 Q95L probably damaging Het
Cpd G T 11: 76,786,338 P1185Q probably damaging Het
Cycs T A 6: 50,565,329 I76F possibly damaging Het
Cyp4f16 T A 17: 32,537,099 I34N probably damaging Het
Ddx1 A C 12: 13,229,331 S436A probably benign Het
Defa30 A G 8: 21,135,484 Y88C probably damaging Het
Dhx30 G A 9: 110,088,672 L317F probably damaging Het
Dll3 C A 7: 28,296,410 G322V probably damaging Het
Dnah10 G A 5: 124,804,689 D2843N probably damaging Het
Dnaja3 C T 16: 4,697,269 T266I probably damaging Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
E030025P04Rik A G 11: 109,143,918 V48A unknown Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Eri3 G A 4: 117,649,365 G297D probably benign Het
Esp34 A G 17: 38,559,533 E38G possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Frzb A G 2: 80,446,380 V154A possibly damaging Het
Fsip2 G T 2: 82,993,257 A6445S possibly damaging Het
Gm11938 G A 11: 99,603,017 T84I possibly damaging Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Gpa33 A G 1: 166,165,190 I291V probably benign Het
Gpr158 A G 2: 21,369,124 Y290C probably damaging Het
Gpsm1 G T 2: 26,344,713 G84W probably damaging Het
Hormad1 A G 3: 95,580,006 N267S probably benign Het
Htr2a A T 14: 74,705,753 I258F probably damaging Het
Htra4 T C 8: 25,033,581 T323A probably damaging Het
Ift140 T A 17: 25,035,839 F162Y probably benign Het
Kcna4 T G 2: 107,296,484 V521G probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Kif6 G T 17: 49,901,771 A740S probably benign Het
Lad1 T A 1: 135,827,730 V248E probably damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Lamc1 A G 1: 153,249,872 Y552H probably damaging Het
Maats1 T C 16: 38,324,297 probably null Het
Mctp1 A T 13: 76,825,741 T706S probably damaging Het
Med12l A G 3: 59,260,772 Y1541C probably damaging Het
Mnx1 C T 5: 29,477,782 S165N unknown Het
Morn3 A T 5: 123,046,629 probably null Het
Nalcn C T 14: 123,460,412 R484Q probably damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Olfr30 G A 11: 58,455,431 R173W probably damaging Het
Olfr339 C T 2: 36,421,874 H159Y probably damaging Het
Pcdhb5 T C 18: 37,322,340 V591A possibly damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Phactr3 C A 2: 178,283,147 L292M probably damaging Het
Phf21b T A 15: 84,854,762 I21F probably benign Het
Pign A G 1: 105,554,498 V791A probably damaging Het
Pitpna A G 11: 75,609,103 probably null Het
Piwil1 G T 5: 128,747,839 E534* probably null Het
Plcz1 T A 6: 139,993,049 I526F probably benign Het
Pms2 A T 5: 143,925,896 K607I probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Polq C T 16: 37,062,109 T1545I probably benign Het
Psd4 G A 2: 24,397,456 E467K probably benign Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Pzp T C 6: 128,502,225 Y655C probably damaging Het
Qrsl1 C T 10: 43,894,545 G117E probably damaging Het
Rad54b G A 4: 11,601,669 C408Y probably damaging Het
Ralb T A 1: 119,476,067 Q110L possibly damaging Het
Rrm2 A G 12: 24,713,152 K218E probably damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc17a8 A T 10: 89,606,765 C69S unknown Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc38a11 A T 2: 65,363,516 probably null Het
Smarcal1 G A 1: 72,586,099 G135D possibly damaging Het
Snrnp70 T A 7: 45,377,220 R242* probably null Het
St3gal5 T C 6: 72,132,093 L55P probably damaging Het
Sulf1 A G 1: 12,838,437 N558S probably benign Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tas2r113 T A 6: 132,893,329 Y107N probably damaging Het
Tcf7 A G 11: 52,257,064 V187A probably benign Het
Tdrd9 G A 12: 112,044,812 G1152R probably damaging Het
Tfpi A G 2: 84,458,107 Y9H probably benign Het
Tnk2 G A 16: 32,680,142 V758I probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trip12 T A 1: 84,728,145 N655Y probably damaging Het
Ttn A G 2: 76,751,429 V23040A probably damaging Het
Tulp2 T A 7: 45,517,943 N188K probably damaging Het
Ube2c C T 2: 164,771,362 H67Y probably damaging Het
Unc80 C A 1: 66,631,414 P1899T possibly damaging Het
Usp34 C T 11: 23,426,153 A1879V probably benign Het
Vmn2r118 G A 17: 55,611,556 S112L possibly damaging Het
Wdfy3 A T 5: 101,888,186 V2122E probably benign Het
Zcchc4 A G 5: 52,815,826 Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zdhhc25 A T 15: 88,600,486 H8L probably benign Het
Zfp455 A T 13: 67,207,817 H383L probably damaging Het
Zfp663 A G 2: 165,353,291 I336T probably benign Het
Zfp738 T A 13: 67,670,357 H505L probably damaging Het
Zfp84 T G 7: 29,775,371 F23V possibly damaging Het
Other mutations in Islr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Islr2 APN 9 58199786 missense probably benign 0.03
IGL01444:Islr2 APN 9 58198378 missense probably damaging 1.00
R0346:Islr2 UTSW 9 58198343 nonsense probably null
R0360:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0364:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0528:Islr2 UTSW 9 58199362 missense probably damaging 0.97
R0693:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R2893:Islr2 UTSW 9 58197866 missense probably damaging 1.00
R3747:Islr2 UTSW 9 58199642 missense probably benign 0.00
R3914:Islr2 UTSW 9 58198383 nonsense probably null
R4176:Islr2 UTSW 9 58199900 missense probably damaging 1.00
R4212:Islr2 UTSW 9 58199320 missense probably damaging 1.00
R4844:Islr2 UTSW 9 58208234 unclassified probably benign
R5303:Islr2 UTSW 9 58208275 unclassified probably benign
R5636:Islr2 UTSW 9 58201301 missense probably benign 0.03
R5787:Islr2 UTSW 9 58198354 missense probably damaging 0.97
R5883:Islr2 UTSW 9 58198715 missense probably benign 0.01
R6406:Islr2 UTSW 9 58199980 missense probably benign
R7105:Islr2 UTSW 9 58197814 missense probably damaging 1.00
R7130:Islr2 UTSW 9 58198292 missense probably damaging 1.00
R7316:Islr2 UTSW 9 58197967 missense probably damaging 0.99
X0026:Islr2 UTSW 9 58198286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTTCAGCAGCTGCAGC -3'
(R):5'- TTGACTTCCCTCTGCAGGAG -3'

Sequencing Primer
(F):5'- GCGCTCAAGTTACGAAGGTC -3'
(R):5'- TCTGCAGGAGTCACGATGG -3'
Posted On2014-06-23