Incidental Mutation 'R1854:Usp34'
ID 205945
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 039878-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock # R1854 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23306895-23490560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23426153 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1879 (A1879V)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000130131
AA Change: A120V

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342
AA Change: A120V

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Pfam:UCH 171 514 1.1e-48 PFAM
Pfam:UCH_1 172 470 1.6e-25 PFAM
low complexity region 763 785 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: A1898V
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: A1898V

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: A1879V

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: A1879V

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,707,780 R43K possibly damaging Het
Acp1 A G 12: 30,897,805 I78T possibly damaging Het
Afap1l1 G T 18: 61,743,294 D417E probably benign Het
Agap2 G A 10: 127,080,516 V299I unknown Het
Ahnak C T 19: 9,013,832 A4160V possibly damaging Het
Anapc1 T C 2: 128,675,890 E278G probably damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atg2a A G 19: 6,252,431 E928G probably benign Het
Atp2b2 A C 6: 113,842,283 N16K probably damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
Bfsp2 C T 9: 103,449,831 G236S probably benign Het
Ccar1 A T 10: 62,764,517 I545N probably damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cdc42bpg A T 19: 6,320,807 H1310L possibly damaging Het
Ces1h T C 8: 93,358,822 K339E probably benign Het
Cit A G 5: 115,873,901 Y189C probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Cntrl A G 2: 35,122,684 D278G probably damaging Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Col6a1 T G 10: 76,721,949 Y151S probably damaging Het
Col6a2 T A 10: 76,614,812 Q95L probably damaging Het
Cpd G T 11: 76,786,338 P1185Q probably damaging Het
Cycs T A 6: 50,565,329 I76F possibly damaging Het
Cyp4f16 T A 17: 32,537,099 I34N probably damaging Het
Ddx1 A C 12: 13,229,331 S436A probably benign Het
Defa30 A G 8: 21,135,484 Y88C probably damaging Het
Dhx30 G A 9: 110,088,672 L317F probably damaging Het
Dll3 C A 7: 28,296,410 G322V probably damaging Het
Dnah10 G A 5: 124,804,689 D2843N probably damaging Het
Dnaja3 C T 16: 4,697,269 T266I probably damaging Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
E030025P04Rik A G 11: 109,143,918 V48A unknown Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Eri3 G A 4: 117,649,365 G297D probably benign Het
Esp34 A G 17: 38,559,533 E38G possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Frzb A G 2: 80,446,380 V154A possibly damaging Het
Fsip2 G T 2: 82,993,257 A6445S possibly damaging Het
Gm11938 G A 11: 99,603,017 T84I possibly damaging Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Gpa33 A G 1: 166,165,190 I291V probably benign Het
Gpr158 A G 2: 21,369,124 Y290C probably damaging Het
Gpsm1 G T 2: 26,344,713 G84W probably damaging Het
Hormad1 A G 3: 95,580,006 N267S probably benign Het
Htr2a A T 14: 74,705,753 I258F probably damaging Het
Htra4 T C 8: 25,033,581 T323A probably damaging Het
Ift140 T A 17: 25,035,839 F162Y probably benign Het
Islr2 T C 9: 58,199,816 T54A probably damaging Het
Kcna4 T G 2: 107,296,484 V521G probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Kif6 G T 17: 49,901,771 A740S probably benign Het
Lad1 T A 1: 135,827,730 V248E probably damaging Het
Lamb1 T G 12: 31,318,272 C1134G probably damaging Het
Lamc1 A G 1: 153,249,872 Y552H probably damaging Het
Maats1 T C 16: 38,324,297 probably null Het
Mctp1 A T 13: 76,825,741 T706S probably damaging Het
Med12l A G 3: 59,260,772 Y1541C probably damaging Het
Mnx1 C T 5: 29,477,782 S165N unknown Het
Morn3 A T 5: 123,046,629 probably null Het
Nalcn C T 14: 123,460,412 R484Q probably damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Olfr30 G A 11: 58,455,431 R173W probably damaging Het
Olfr339 C T 2: 36,421,874 H159Y probably damaging Het
Pcdhb5 T C 18: 37,322,340 V591A possibly damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Phactr3 C A 2: 178,283,147 L292M probably damaging Het
Phf21b T A 15: 84,854,762 I21F probably benign Het
Pign A G 1: 105,554,498 V791A probably damaging Het
Pitpna A G 11: 75,609,103 probably null Het
Piwil1 G T 5: 128,747,839 E534* probably null Het
Plcz1 T A 6: 139,993,049 I526F probably benign Het
Pms2 A T 5: 143,925,896 K607I probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Polq C T 16: 37,062,109 T1545I probably benign Het
Psd4 G A 2: 24,397,456 E467K probably benign Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Pzp T C 6: 128,502,225 Y655C probably damaging Het
Qrsl1 C T 10: 43,894,545 G117E probably damaging Het
Rad54b G A 4: 11,601,669 C408Y probably damaging Het
Ralb T A 1: 119,476,067 Q110L possibly damaging Het
Rrm2 A G 12: 24,713,152 K218E probably damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc17a8 A T 10: 89,606,765 C69S unknown Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc38a11 A T 2: 65,363,516 probably null Het
Smarcal1 G A 1: 72,586,099 G135D possibly damaging Het
Snrnp70 T A 7: 45,377,220 R242* probably null Het
St3gal5 T C 6: 72,132,093 L55P probably damaging Het
Sulf1 A G 1: 12,838,437 N558S probably benign Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tas2r113 T A 6: 132,893,329 Y107N probably damaging Het
Tcf7 A G 11: 52,257,064 V187A probably benign Het
Tdrd9 G A 12: 112,044,812 G1152R probably damaging Het
Tfpi A G 2: 84,458,107 Y9H probably benign Het
Tnk2 G A 16: 32,680,142 V758I probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trip12 T A 1: 84,728,145 N655Y probably damaging Het
Ttn A G 2: 76,751,429 V23040A probably damaging Het
Tulp2 T A 7: 45,517,943 N188K probably damaging Het
Ube2c C T 2: 164,771,362 H67Y probably damaging Het
Unc80 C A 1: 66,631,414 P1899T possibly damaging Het
Vmn2r118 G A 17: 55,611,556 S112L possibly damaging Het
Wdfy3 A T 5: 101,888,186 V2122E probably benign Het
Zcchc4 A G 5: 52,815,826 Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zdhhc25 A T 15: 88,600,486 H8L probably benign Het
Zfp455 A T 13: 67,207,817 H383L probably damaging Het
Zfp663 A G 2: 165,353,291 I336T probably benign Het
Zfp738 T A 13: 67,670,357 H505L probably damaging Het
Zfp84 T G 7: 29,775,371 F23V possibly damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
Chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23457975 missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23343515 missense possibly damaging 0.94
Roebuck UTSW 11 23486810 splice site probably benign
stoat UTSW 11 23487203 missense
tunnelvision UTSW 11 23446968 missense
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 splice site probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7358:Usp34 UTSW 11 23361683 missense probably damaging 0.99
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7459:Usp34 UTSW 11 23364458 missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23446968 missense
R7729:Usp34 UTSW 11 23449268 missense
R7777:Usp34 UTSW 11 23382638 missense
R7810:Usp34 UTSW 11 23412314 missense
R7836:Usp34 UTSW 11 23446614 missense
R7862:Usp34 UTSW 11 23464718 missense
R7993:Usp34 UTSW 11 23377622 missense
R8050:Usp34 UTSW 11 23446787 missense
R8054:Usp34 UTSW 11 23361295 missense
R8239:Usp34 UTSW 11 23446750 missense
R8266:Usp34 UTSW 11 23486810 splice site probably benign
R8347:Usp34 UTSW 11 23412345 missense
R8409:Usp34 UTSW 11 23457811 missense
R8692:Usp34 UTSW 11 23429325 missense
R8694:Usp34 UTSW 11 23484161 missense
R8734:Usp34 UTSW 11 23444184 missense
R8806:Usp34 UTSW 11 23484143 missense
R8914:Usp34 UTSW 11 23343604 missense
R8987:Usp34 UTSW 11 23464267 missense
R9013:Usp34 UTSW 11 23370302 missense
R9108:Usp34 UTSW 11 23370528 missense
R9264:Usp34 UTSW 11 23489064 missense
R9301:Usp34 UTSW 11 23472951 missense
R9375:Usp34 UTSW 11 23487203 missense
R9385:Usp34 UTSW 11 23449223 missense
R9500:Usp34 UTSW 11 23381337 missense probably damaging 0.99
R9566:Usp34 UTSW 11 23367529 missense
R9629:Usp34 UTSW 11 23364364 missense
R9679:Usp34 UTSW 11 23444369 missense
R9680:Usp34 UTSW 11 23367385 missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23474351 missense
R9752:Usp34 UTSW 11 23459182 missense probably benign 0.11
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23473221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGTCCATTCTGTTCCG -3'
(R):5'- CAAGTGTGCGAAAAGGTGATTC -3'

Sequencing Primer
(F):5'- ACTTTGGTGATGATTTATGATACTGC -3'
(R):5'- GTGTGCGAAAAGGTGATTCTTTAATC -3'
Posted On 2014-06-23