Incidental Mutation 'R1854:Usp34'
ID 205945
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 039878-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.831) question?
Stock # R1854 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23376153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1879 (A1879V)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130131] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000130131
AA Change: A120V

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115168
Gene: ENSMUSG00000056342
AA Change: A120V

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Pfam:UCH 171 514 1.1e-48 PFAM
Pfam:UCH_1 172 470 1.6e-25 PFAM
low complexity region 763 785 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: A1898V
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: A1898V

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: A1879V

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: A1879V

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,504,668 (GRCm39) R43K possibly damaging Het
Acp1 A G 12: 30,947,804 (GRCm39) I78T possibly damaging Het
Afap1l1 G T 18: 61,876,365 (GRCm39) D417E probably benign Het
Agap2 G A 10: 126,916,385 (GRCm39) V299I unknown Het
Ahnak C T 19: 8,991,196 (GRCm39) A4160V possibly damaging Het
Anapc1 T C 2: 128,517,810 (GRCm39) E278G probably damaging Het
Atad2 G A 15: 57,960,685 (GRCm39) P971L possibly damaging Het
Atg2a A G 19: 6,302,461 (GRCm39) E928G probably benign Het
Atp2b2 A C 6: 113,819,244 (GRCm39) N16K probably damaging Het
Atp6ap1l T C 13: 91,031,707 (GRCm39) E325G probably damaging Het
Bfsp2 C T 9: 103,327,030 (GRCm39) G236S probably benign Het
Ccar1 A T 10: 62,600,296 (GRCm39) I545N probably damaging Het
Ccser2 A G 14: 36,640,548 (GRCm39) C11R possibly damaging Het
Cdc42bpg A T 19: 6,370,837 (GRCm39) H1310L possibly damaging Het
Ces1h T C 8: 94,085,450 (GRCm39) K339E probably benign Het
Cfap91 T C 16: 38,144,659 (GRCm39) probably null Het
Cit A G 5: 116,011,960 (GRCm39) Y189C probably damaging Het
Cnih3 C A 1: 181,282,186 (GRCm39) S140* probably null Het
Cntrl A G 2: 35,012,696 (GRCm39) D278G probably damaging Het
Col24a1 G A 3: 145,164,895 (GRCm39) G1033D probably damaging Het
Col6a1 T G 10: 76,557,783 (GRCm39) Y151S probably damaging Het
Col6a2 T A 10: 76,450,646 (GRCm39) Q95L probably damaging Het
Cpd G T 11: 76,677,164 (GRCm39) P1185Q probably damaging Het
Cycs T A 6: 50,542,309 (GRCm39) I76F possibly damaging Het
Cyp4f16 T A 17: 32,756,073 (GRCm39) I34N probably damaging Het
Ddx1 A C 12: 13,279,332 (GRCm39) S436A probably benign Het
Defa30 A G 8: 21,625,500 (GRCm39) Y88C probably damaging Het
Dhx30 G A 9: 109,917,740 (GRCm39) L317F probably damaging Het
Dll3 C A 7: 27,995,835 (GRCm39) G322V probably damaging Het
Dnah10 G A 5: 124,881,753 (GRCm39) D2843N probably damaging Het
Dnaja3 C T 16: 4,515,133 (GRCm39) T266I probably damaging Het
Dpp9 T C 17: 56,509,885 (GRCm39) I314V probably benign Het
E030025P04Rik A G 11: 109,034,744 (GRCm39) V48A unknown Het
Enpp2 C T 15: 54,709,219 (GRCm39) E803K probably damaging Het
Eri3 G A 4: 117,506,562 (GRCm39) G297D probably benign Het
Esp34 A G 17: 38,870,424 (GRCm39) E38G possibly damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Frzb A G 2: 80,276,724 (GRCm39) V154A possibly damaging Het
Fsip2 G T 2: 82,823,601 (GRCm39) A6445S possibly damaging Het
Gm11938 G A 11: 99,493,843 (GRCm39) T84I possibly damaging Het
Gm4787 T A 12: 81,425,108 (GRCm39) H350L probably damaging Het
Gpa33 A G 1: 165,992,759 (GRCm39) I291V probably benign Het
Gpr158 A G 2: 21,373,935 (GRCm39) Y290C probably damaging Het
Gpsm1 G T 2: 26,234,725 (GRCm39) G84W probably damaging Het
Hormad1 A G 3: 95,487,317 (GRCm39) N267S probably benign Het
Htr2a A T 14: 74,943,193 (GRCm39) I258F probably damaging Het
Htra4 T C 8: 25,523,597 (GRCm39) T323A probably damaging Het
Ift140 T A 17: 25,254,813 (GRCm39) F162Y probably benign Het
Islr2 T C 9: 58,107,099 (GRCm39) T54A probably damaging Het
Kcna4 T G 2: 107,126,829 (GRCm39) V521G probably damaging Het
Kdr C T 5: 76,113,565 (GRCm39) G768S possibly damaging Het
Kif6 G T 17: 50,208,799 (GRCm39) A740S probably benign Het
Lad1 T A 1: 135,755,468 (GRCm39) V248E probably damaging Het
Lamb1 T G 12: 31,368,271 (GRCm39) C1134G probably damaging Het
Lamc1 A G 1: 153,125,618 (GRCm39) Y552H probably damaging Het
Mctp1 A T 13: 76,973,860 (GRCm39) T706S probably damaging Het
Med12l A G 3: 59,168,193 (GRCm39) Y1541C probably damaging Het
Mnx1 C T 5: 29,682,780 (GRCm39) S165N unknown Het
Morn3 A T 5: 123,184,692 (GRCm39) probably null Het
Nalcn C T 14: 123,697,824 (GRCm39) R484Q probably damaging Het
Nr4a1 T C 15: 101,169,645 (GRCm39) I305T probably benign Het
Or1j11 C T 2: 36,311,886 (GRCm39) H159Y probably damaging Het
Or2z2 G A 11: 58,346,257 (GRCm39) R173W probably damaging Het
Pabir2 T A X: 52,342,933 (GRCm39) Q201H probably benign Het
Pcdhb5 T C 18: 37,455,393 (GRCm39) V591A possibly damaging Het
Pdia3 T C 2: 121,262,144 (GRCm39) I205T probably benign Het
Pdia4 A T 6: 47,790,161 (GRCm39) D26E unknown Het
Phactr3 C A 2: 177,924,940 (GRCm39) L292M probably damaging Het
Phf21b T A 15: 84,738,963 (GRCm39) I21F probably benign Het
Pign A G 1: 105,482,223 (GRCm39) V791A probably damaging Het
Pitpna A G 11: 75,499,929 (GRCm39) probably null Het
Piwil1 G T 5: 128,824,903 (GRCm39) E534* probably null Het
Plcz1 T A 6: 139,938,775 (GRCm39) I526F probably benign Het
Pms2 A T 5: 143,862,714 (GRCm39) K607I probably benign Het
Pnn T A 12: 59,118,399 (GRCm39) N327K probably damaging Het
Pogz C T 3: 94,786,160 (GRCm39) T863I probably benign Het
Polq C T 16: 36,882,471 (GRCm39) T1545I probably benign Het
Psd4 G A 2: 24,287,468 (GRCm39) E467K probably benign Het
Pstpip2 T A 18: 77,959,499 (GRCm39) L198Q probably damaging Het
Pzp T C 6: 128,479,188 (GRCm39) Y655C probably damaging Het
Qrsl1 C T 10: 43,770,541 (GRCm39) G117E probably damaging Het
Rad54b G A 4: 11,601,669 (GRCm39) C408Y probably damaging Het
Ralb T A 1: 119,403,797 (GRCm39) Q110L possibly damaging Het
Rrm2 A G 12: 24,763,151 (GRCm39) K218E probably damaging Het
Siglece A G 7: 43,309,360 (GRCm39) F66S probably benign Het
Slc17a8 A T 10: 89,442,627 (GRCm39) C69S unknown Het
Slc1a6 T A 10: 78,648,758 (GRCm39) V493E probably damaging Het
Slc38a11 A T 2: 65,193,860 (GRCm39) probably null Het
Smarcal1 G A 1: 72,625,258 (GRCm39) G135D possibly damaging Het
Snrnp70 T A 7: 45,026,644 (GRCm39) R242* probably null Het
St3gal5 T C 6: 72,109,077 (GRCm39) L55P probably damaging Het
Sulf1 A G 1: 12,908,661 (GRCm39) N558S probably benign Het
Supt6 T C 11: 78,123,366 (GRCm39) I104V possibly damaging Het
Tas2r113 T A 6: 132,870,292 (GRCm39) Y107N probably damaging Het
Tcf7 A G 11: 52,147,891 (GRCm39) V187A probably benign Het
Tdrd9 G A 12: 112,011,246 (GRCm39) G1152R probably damaging Het
Tfpi A G 2: 84,288,451 (GRCm39) Y9H probably benign Het
Tnk2 G A 16: 32,498,960 (GRCm39) V758I probably damaging Het
Trim72 A G 7: 127,608,254 (GRCm39) I251V probably benign Het
Trip12 T A 1: 84,705,866 (GRCm39) N655Y probably damaging Het
Ttn A G 2: 76,581,773 (GRCm39) V23040A probably damaging Het
Tulp2 T A 7: 45,167,367 (GRCm39) N188K probably damaging Het
Ube2c C T 2: 164,613,282 (GRCm39) H67Y probably damaging Het
Unc80 C A 1: 66,670,573 (GRCm39) P1899T possibly damaging Het
Vmn2r118 G A 17: 55,918,556 (GRCm39) S112L possibly damaging Het
Wdfy3 A T 5: 102,036,052 (GRCm39) V2122E probably benign Het
Zcchc4 A G 5: 52,973,168 (GRCm39) Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,344,701 (GRCm39) probably null Het
Zdhhc25 A T 15: 88,484,689 (GRCm39) H8L probably benign Het
Zfp455 A T 13: 67,355,881 (GRCm39) H383L probably damaging Het
Zfp663 A G 2: 165,195,211 (GRCm39) I336T probably benign Het
Zfp738 T A 13: 67,818,476 (GRCm39) H505L probably damaging Het
Zfp84 T G 7: 29,474,796 (GRCm39) F23V possibly damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGTCCATTCTGTTCCG -3'
(R):5'- CAAGTGTGCGAAAAGGTGATTC -3'

Sequencing Primer
(F):5'- ACTTTGGTGATGATTTATGATACTGC -3'
(R):5'- GTGTGCGAAAAGGTGATTCTTTAATC -3'
Posted On 2014-06-23