Incidental Mutation 'R0113:G3bp1'
ID 20598
Institutional Source Beutler Lab
Gene Symbol G3bp1
Ensembl Gene ENSMUSG00000018583
Gene Name GTPase activating protein (SH3 domain) binding protein 1
Synonyms GAP SH3 binding protein
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0113 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 55469685-55504838 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55495426 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 237 (V237E)
Ref Sequence ENSEMBL: ENSMUSP00000018727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018727]
AlphaFold P97855
Predicted Effect probably benign
Transcript: ENSMUST00000018727
AA Change: V237E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: V237E

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.8e-35 PFAM
low complexity region 142 167 N/A INTRINSIC
low complexity region 187 206 N/A INTRINSIC
low complexity region 211 225 N/A INTRINSIC
low complexity region 289 305 N/A INTRINSIC
RRM 339 409 1.49e-13 SMART
low complexity region 419 447 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in G3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02231:G3bp1 APN 11 55495447 nonsense probably null
silverheels UTSW 11 55489116 missense possibly damaging 0.95
R0056:G3bp1 UTSW 11 55498041 missense probably benign 0.03
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0240:G3bp1 UTSW 11 55492028 missense probably damaging 1.00
R0311:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0312:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0367:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0368:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0454:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0464:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0465:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0466:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0467:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0486:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0487:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0533:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0551:G3bp1 UTSW 11 55489143 missense probably benign 0.01
R0689:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R0848:G3bp1 UTSW 11 55498626 missense probably damaging 1.00
R2109:G3bp1 UTSW 11 55489160 missense probably damaging 0.97
R5129:G3bp1 UTSW 11 55489116 missense possibly damaging 0.95
R5439:G3bp1 UTSW 11 55497987 missense probably damaging 0.96
R5834:G3bp1 UTSW 11 55497940 missense probably benign
R6692:G3bp1 UTSW 11 55493509 missense probably benign 0.00
R6925:G3bp1 UTSW 11 55497960 missense possibly damaging 0.47
R7091:G3bp1 UTSW 11 55496221 missense possibly damaging 0.94
R8348:G3bp1 UTSW 11 55498631 missense possibly damaging 0.81
R9375:G3bp1 UTSW 11 55499613 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGGAGGAGCATTTAGAGGAGCC -3'
(R):5'- TTAGGGGACCAAGATAAGCCAGCC -3'

Sequencing Primer
(F):5'- CCTGTAGTGGAAccagaaccg -3'
(R):5'- tgaaaggcagaggtaagtgg -3'
Posted On 2013-04-11