Incidental Mutation 'R1854:Polq'
ID 205980
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission 039878-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.509) question?
Stock # R1854 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36832148-36915779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 36882471 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1545 (T1545I)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect probably benign
Transcript: ENSMUST00000054034
AA Change: T1545I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: T1545I

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071452
AA Change: T1266I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: T1266I

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182622
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,504,668 (GRCm39) R43K possibly damaging Het
Acp1 A G 12: 30,947,804 (GRCm39) I78T possibly damaging Het
Afap1l1 G T 18: 61,876,365 (GRCm39) D417E probably benign Het
Agap2 G A 10: 126,916,385 (GRCm39) V299I unknown Het
Ahnak C T 19: 8,991,196 (GRCm39) A4160V possibly damaging Het
Anapc1 T C 2: 128,517,810 (GRCm39) E278G probably damaging Het
Atad2 G A 15: 57,960,685 (GRCm39) P971L possibly damaging Het
Atg2a A G 19: 6,302,461 (GRCm39) E928G probably benign Het
Atp2b2 A C 6: 113,819,244 (GRCm39) N16K probably damaging Het
Atp6ap1l T C 13: 91,031,707 (GRCm39) E325G probably damaging Het
Bfsp2 C T 9: 103,327,030 (GRCm39) G236S probably benign Het
Ccar1 A T 10: 62,600,296 (GRCm39) I545N probably damaging Het
Ccser2 A G 14: 36,640,548 (GRCm39) C11R possibly damaging Het
Cdc42bpg A T 19: 6,370,837 (GRCm39) H1310L possibly damaging Het
Ces1h T C 8: 94,085,450 (GRCm39) K339E probably benign Het
Cfap91 T C 16: 38,144,659 (GRCm39) probably null Het
Cit A G 5: 116,011,960 (GRCm39) Y189C probably damaging Het
Cnih3 C A 1: 181,282,186 (GRCm39) S140* probably null Het
Cntrl A G 2: 35,012,696 (GRCm39) D278G probably damaging Het
Col24a1 G A 3: 145,164,895 (GRCm39) G1033D probably damaging Het
Col6a1 T G 10: 76,557,783 (GRCm39) Y151S probably damaging Het
Col6a2 T A 10: 76,450,646 (GRCm39) Q95L probably damaging Het
Cpd G T 11: 76,677,164 (GRCm39) P1185Q probably damaging Het
Cycs T A 6: 50,542,309 (GRCm39) I76F possibly damaging Het
Cyp4f16 T A 17: 32,756,073 (GRCm39) I34N probably damaging Het
Ddx1 A C 12: 13,279,332 (GRCm39) S436A probably benign Het
Defa30 A G 8: 21,625,500 (GRCm39) Y88C probably damaging Het
Dhx30 G A 9: 109,917,740 (GRCm39) L317F probably damaging Het
Dll3 C A 7: 27,995,835 (GRCm39) G322V probably damaging Het
Dnah10 G A 5: 124,881,753 (GRCm39) D2843N probably damaging Het
Dnaja3 C T 16: 4,515,133 (GRCm39) T266I probably damaging Het
Dpp9 T C 17: 56,509,885 (GRCm39) I314V probably benign Het
E030025P04Rik A G 11: 109,034,744 (GRCm39) V48A unknown Het
Enpp2 C T 15: 54,709,219 (GRCm39) E803K probably damaging Het
Eri3 G A 4: 117,506,562 (GRCm39) G297D probably benign Het
Esp34 A G 17: 38,870,424 (GRCm39) E38G possibly damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Frzb A G 2: 80,276,724 (GRCm39) V154A possibly damaging Het
Fsip2 G T 2: 82,823,601 (GRCm39) A6445S possibly damaging Het
Gm11938 G A 11: 99,493,843 (GRCm39) T84I possibly damaging Het
Gm4787 T A 12: 81,425,108 (GRCm39) H350L probably damaging Het
Gpa33 A G 1: 165,992,759 (GRCm39) I291V probably benign Het
Gpr158 A G 2: 21,373,935 (GRCm39) Y290C probably damaging Het
Gpsm1 G T 2: 26,234,725 (GRCm39) G84W probably damaging Het
Hormad1 A G 3: 95,487,317 (GRCm39) N267S probably benign Het
Htr2a A T 14: 74,943,193 (GRCm39) I258F probably damaging Het
Htra4 T C 8: 25,523,597 (GRCm39) T323A probably damaging Het
Ift140 T A 17: 25,254,813 (GRCm39) F162Y probably benign Het
Islr2 T C 9: 58,107,099 (GRCm39) T54A probably damaging Het
Kcna4 T G 2: 107,126,829 (GRCm39) V521G probably damaging Het
Kdr C T 5: 76,113,565 (GRCm39) G768S possibly damaging Het
Kif6 G T 17: 50,208,799 (GRCm39) A740S probably benign Het
Lad1 T A 1: 135,755,468 (GRCm39) V248E probably damaging Het
Lamb1 T G 12: 31,368,271 (GRCm39) C1134G probably damaging Het
Lamc1 A G 1: 153,125,618 (GRCm39) Y552H probably damaging Het
Mctp1 A T 13: 76,973,860 (GRCm39) T706S probably damaging Het
Med12l A G 3: 59,168,193 (GRCm39) Y1541C probably damaging Het
Mnx1 C T 5: 29,682,780 (GRCm39) S165N unknown Het
Morn3 A T 5: 123,184,692 (GRCm39) probably null Het
Nalcn C T 14: 123,697,824 (GRCm39) R484Q probably damaging Het
Nr4a1 T C 15: 101,169,645 (GRCm39) I305T probably benign Het
Or1j11 C T 2: 36,311,886 (GRCm39) H159Y probably damaging Het
Or2z2 G A 11: 58,346,257 (GRCm39) R173W probably damaging Het
Pabir2 T A X: 52,342,933 (GRCm39) Q201H probably benign Het
Pcdhb5 T C 18: 37,455,393 (GRCm39) V591A possibly damaging Het
Pdia3 T C 2: 121,262,144 (GRCm39) I205T probably benign Het
Pdia4 A T 6: 47,790,161 (GRCm39) D26E unknown Het
Phactr3 C A 2: 177,924,940 (GRCm39) L292M probably damaging Het
Phf21b T A 15: 84,738,963 (GRCm39) I21F probably benign Het
Pign A G 1: 105,482,223 (GRCm39) V791A probably damaging Het
Pitpna A G 11: 75,499,929 (GRCm39) probably null Het
Piwil1 G T 5: 128,824,903 (GRCm39) E534* probably null Het
Plcz1 T A 6: 139,938,775 (GRCm39) I526F probably benign Het
Pms2 A T 5: 143,862,714 (GRCm39) K607I probably benign Het
Pnn T A 12: 59,118,399 (GRCm39) N327K probably damaging Het
Pogz C T 3: 94,786,160 (GRCm39) T863I probably benign Het
Psd4 G A 2: 24,287,468 (GRCm39) E467K probably benign Het
Pstpip2 T A 18: 77,959,499 (GRCm39) L198Q probably damaging Het
Pzp T C 6: 128,479,188 (GRCm39) Y655C probably damaging Het
Qrsl1 C T 10: 43,770,541 (GRCm39) G117E probably damaging Het
Rad54b G A 4: 11,601,669 (GRCm39) C408Y probably damaging Het
Ralb T A 1: 119,403,797 (GRCm39) Q110L possibly damaging Het
Rrm2 A G 12: 24,763,151 (GRCm39) K218E probably damaging Het
Siglece A G 7: 43,309,360 (GRCm39) F66S probably benign Het
Slc17a8 A T 10: 89,442,627 (GRCm39) C69S unknown Het
Slc1a6 T A 10: 78,648,758 (GRCm39) V493E probably damaging Het
Slc38a11 A T 2: 65,193,860 (GRCm39) probably null Het
Smarcal1 G A 1: 72,625,258 (GRCm39) G135D possibly damaging Het
Snrnp70 T A 7: 45,026,644 (GRCm39) R242* probably null Het
St3gal5 T C 6: 72,109,077 (GRCm39) L55P probably damaging Het
Sulf1 A G 1: 12,908,661 (GRCm39) N558S probably benign Het
Supt6 T C 11: 78,123,366 (GRCm39) I104V possibly damaging Het
Tas2r113 T A 6: 132,870,292 (GRCm39) Y107N probably damaging Het
Tcf7 A G 11: 52,147,891 (GRCm39) V187A probably benign Het
Tdrd9 G A 12: 112,011,246 (GRCm39) G1152R probably damaging Het
Tfpi A G 2: 84,288,451 (GRCm39) Y9H probably benign Het
Tnk2 G A 16: 32,498,960 (GRCm39) V758I probably damaging Het
Trim72 A G 7: 127,608,254 (GRCm39) I251V probably benign Het
Trip12 T A 1: 84,705,866 (GRCm39) N655Y probably damaging Het
Ttn A G 2: 76,581,773 (GRCm39) V23040A probably damaging Het
Tulp2 T A 7: 45,167,367 (GRCm39) N188K probably damaging Het
Ube2c C T 2: 164,613,282 (GRCm39) H67Y probably damaging Het
Unc80 C A 1: 66,670,573 (GRCm39) P1899T possibly damaging Het
Usp34 C T 11: 23,376,153 (GRCm39) A1879V probably benign Het
Vmn2r118 G A 17: 55,918,556 (GRCm39) S112L possibly damaging Het
Wdfy3 A T 5: 102,036,052 (GRCm39) V2122E probably benign Het
Zcchc4 A G 5: 52,973,168 (GRCm39) Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,344,701 (GRCm39) probably null Het
Zdhhc25 A T 15: 88,484,689 (GRCm39) H8L probably benign Het
Zfp455 A T 13: 67,355,881 (GRCm39) H383L probably damaging Het
Zfp663 A G 2: 165,195,211 (GRCm39) I336T probably benign Het
Zfp738 T A 13: 67,818,476 (GRCm39) H505L probably damaging Het
Zfp84 T G 7: 29,474,796 (GRCm39) F23V possibly damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 36,885,609 (GRCm39) splice site probably benign
IGL00539:Polq APN 16 36,880,931 (GRCm39) missense probably damaging 0.98
IGL00960:Polq APN 16 36,880,874 (GRCm39) missense probably damaging 0.96
IGL01100:Polq APN 16 36,881,474 (GRCm39) missense probably benign
IGL01112:Polq APN 16 36,837,671 (GRCm39) missense probably damaging 1.00
IGL01138:Polq APN 16 36,866,231 (GRCm39) missense possibly damaging 0.94
IGL01432:Polq APN 16 36,892,184 (GRCm39) splice site probably benign
IGL01522:Polq APN 16 36,848,265 (GRCm39) missense probably damaging 1.00
IGL01565:Polq APN 16 36,833,475 (GRCm39) missense probably benign 0.00
IGL01592:Polq APN 16 36,855,212 (GRCm39) missense probably benign 0.01
IGL01690:Polq APN 16 36,883,200 (GRCm39) missense probably damaging 0.97
IGL01943:Polq APN 16 36,881,805 (GRCm39) missense possibly damaging 0.47
IGL02531:Polq APN 16 36,882,736 (GRCm39) missense possibly damaging 0.75
IGL02553:Polq APN 16 36,862,130 (GRCm39) missense probably damaging 1.00
IGL02623:Polq APN 16 36,880,737 (GRCm39) missense probably benign 0.04
IGL02692:Polq APN 16 36,880,989 (GRCm39) missense probably damaging 1.00
IGL02717:Polq APN 16 36,843,102 (GRCm39) missense probably damaging 1.00
IGL02937:Polq APN 16 36,833,471 (GRCm39) missense probably benign 0.14
IGL02959:Polq APN 16 36,906,928 (GRCm39) missense probably damaging 1.00
IGL03086:Polq APN 16 36,911,411 (GRCm39) missense probably benign 0.02
IGL03141:Polq APN 16 36,837,720 (GRCm39) splice site probably benign
IGL03302:Polq APN 16 36,892,134 (GRCm39) missense probably damaging 1.00
IGL03393:Polq APN 16 36,865,156 (GRCm39) missense probably damaging 1.00
R0013_Polq_667 UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280_polq_867 UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
G1Funyon:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
PIT4403001:Polq UTSW 16 36,880,949 (GRCm39) missense probably benign 0.00
R0013:Polq UTSW 16 36,882,201 (GRCm39) missense possibly damaging 0.56
R0082:Polq UTSW 16 36,837,619 (GRCm39) missense probably benign 0.01
R0212:Polq UTSW 16 36,887,216 (GRCm39) missense probably damaging 0.99
R0387:Polq UTSW 16 36,909,679 (GRCm39) missense probably damaging 1.00
R0387:Polq UTSW 16 36,849,792 (GRCm39) missense probably damaging 1.00
R0427:Polq UTSW 16 36,882,355 (GRCm39) nonsense probably null
R0454:Polq UTSW 16 36,855,252 (GRCm39) missense probably damaging 0.98
R0513:Polq UTSW 16 36,914,864 (GRCm39) missense probably damaging 1.00
R0622:Polq UTSW 16 36,881,355 (GRCm39) missense probably benign 0.02
R0848:Polq UTSW 16 36,882,492 (GRCm39) missense probably benign 0.08
R1142:Polq UTSW 16 36,833,579 (GRCm39) missense probably damaging 0.98
R1218:Polq UTSW 16 36,849,808 (GRCm39) missense possibly damaging 0.93
R1331:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R1398:Polq UTSW 16 36,882,857 (GRCm39) missense possibly damaging 0.87
R1424:Polq UTSW 16 36,906,890 (GRCm39) missense probably damaging 1.00
R1644:Polq UTSW 16 36,880,626 (GRCm39) missense probably damaging 0.96
R1777:Polq UTSW 16 36,880,586 (GRCm39) missense possibly damaging 0.94
R1820:Polq UTSW 16 36,849,780 (GRCm39) missense possibly damaging 0.48
R1880:Polq UTSW 16 36,906,954 (GRCm39) missense possibly damaging 0.90
R1932:Polq UTSW 16 36,882,666 (GRCm39) missense possibly damaging 0.92
R2008:Polq UTSW 16 36,882,844 (GRCm39) missense probably damaging 0.96
R2014:Polq UTSW 16 36,898,728 (GRCm39) missense probably damaging 1.00
R2026:Polq UTSW 16 36,883,107 (GRCm39) missense possibly damaging 0.93
R2178:Polq UTSW 16 36,883,191 (GRCm39) missense probably damaging 1.00
R2259:Polq UTSW 16 36,882,459 (GRCm39) missense probably benign 0.03
R2266:Polq UTSW 16 36,882,515 (GRCm39) missense possibly damaging 0.59
R2305:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R2370:Polq UTSW 16 36,894,301 (GRCm39) missense probably damaging 1.00
R2504:Polq UTSW 16 36,832,304 (GRCm39) missense unknown
R2517:Polq UTSW 16 36,909,687 (GRCm39) missense probably damaging 1.00
R2697:Polq UTSW 16 36,862,515 (GRCm39) missense probably damaging 1.00
R2858:Polq UTSW 16 36,883,115 (GRCm39) missense possibly damaging 0.88
R3436:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3437:Polq UTSW 16 36,882,699 (GRCm39) missense probably damaging 0.99
R3699:Polq UTSW 16 36,862,518 (GRCm39) missense probably damaging 1.00
R3838:Polq UTSW 16 36,898,711 (GRCm39) missense probably damaging 1.00
R3875:Polq UTSW 16 36,894,389 (GRCm39) missense probably damaging 0.99
R4050:Polq UTSW 16 36,913,182 (GRCm39) critical splice acceptor site probably null
R4172:Polq UTSW 16 36,881,120 (GRCm39) missense probably benign 0.02
R4238:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4240:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4280:Polq UTSW 16 36,902,419 (GRCm39) missense probably damaging 1.00
R4296:Polq UTSW 16 36,881,663 (GRCm39) missense possibly damaging 0.94
R4360:Polq UTSW 16 36,880,701 (GRCm39) missense probably benign 0.00
R4373:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4375:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4376:Polq UTSW 16 36,833,543 (GRCm39) missense probably damaging 1.00
R4509:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4510:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4511:Polq UTSW 16 36,868,925 (GRCm39) missense probably damaging 1.00
R4543:Polq UTSW 16 36,881,147 (GRCm39) missense probably benign 0.43
R4633:Polq UTSW 16 36,868,904 (GRCm39) missense probably damaging 1.00
R4739:Polq UTSW 16 36,862,109 (GRCm39) missense probably damaging 1.00
R4834:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 1.00
R4841:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4842:Polq UTSW 16 36,869,145 (GRCm39) critical splice donor site probably null
R4937:Polq UTSW 16 36,848,274 (GRCm39) missense probably benign 0.01
R4955:Polq UTSW 16 36,881,444 (GRCm39) missense probably benign 0.32
R4992:Polq UTSW 16 36,881,524 (GRCm39) missense possibly damaging 0.59
R5008:Polq UTSW 16 36,882,749 (GRCm39) missense probably benign
R5221:Polq UTSW 16 36,862,540 (GRCm39) missense probably damaging 0.98
R5254:Polq UTSW 16 36,909,681 (GRCm39) missense probably damaging 1.00
R5292:Polq UTSW 16 36,881,745 (GRCm39) missense probably damaging 1.00
R5375:Polq UTSW 16 36,903,146 (GRCm39) missense probably damaging 1.00
R5480:Polq UTSW 16 36,833,652 (GRCm39) splice site probably benign
R5552:Polq UTSW 16 36,914,872 (GRCm39) missense possibly damaging 0.93
R5591:Polq UTSW 16 36,832,247 (GRCm39) utr 5 prime probably benign
R5653:Polq UTSW 16 36,860,896 (GRCm39) missense probably damaging 1.00
R5708:Polq UTSW 16 36,881,380 (GRCm39) missense probably damaging 0.98
R5754:Polq UTSW 16 36,837,625 (GRCm39) missense probably benign
R5757:Polq UTSW 16 36,907,043 (GRCm39) missense probably benign 0.01
R5764:Polq UTSW 16 36,837,706 (GRCm39) missense probably damaging 0.97
R6019:Polq UTSW 16 36,882,126 (GRCm39) missense probably damaging 1.00
R6170:Polq UTSW 16 36,866,174 (GRCm39) missense possibly damaging 0.82
R6177:Polq UTSW 16 36,892,071 (GRCm39) missense probably damaging 0.98
R6307:Polq UTSW 16 36,837,718 (GRCm39) critical splice donor site probably null
R6499:Polq UTSW 16 36,881,189 (GRCm39) missense probably benign 0.03
R6520:Polq UTSW 16 36,880,739 (GRCm39) missense possibly damaging 0.88
R6598:Polq UTSW 16 36,881,993 (GRCm39) missense probably benign 0.39
R6694:Polq UTSW 16 36,835,535 (GRCm39) missense probably null 0.99
R6788:Polq UTSW 16 36,897,510 (GRCm39) missense probably damaging 1.00
R7104:Polq UTSW 16 36,909,715 (GRCm39) nonsense probably null
R7159:Polq UTSW 16 36,883,215 (GRCm39) missense possibly damaging 0.87
R7222:Polq UTSW 16 36,906,995 (GRCm39) nonsense probably null
R7340:Polq UTSW 16 36,881,288 (GRCm39) missense probably benign 0.00
R7361:Polq UTSW 16 36,880,790 (GRCm39) missense probably benign 0.00
R7384:Polq UTSW 16 36,849,780 (GRCm39) missense probably damaging 1.00
R7509:Polq UTSW 16 36,880,706 (GRCm39) missense probably benign 0.00
R7509:Polq UTSW 16 36,880,705 (GRCm39) missense probably benign
R7575:Polq UTSW 16 36,911,496 (GRCm39) missense probably benign 0.00
R7785:Polq UTSW 16 36,848,239 (GRCm39) missense probably damaging 1.00
R7787:Polq UTSW 16 36,837,671 (GRCm39) missense probably damaging 1.00
R7891:Polq UTSW 16 36,848,244 (GRCm39) missense probably damaging 1.00
R7898:Polq UTSW 16 36,865,245 (GRCm39) missense probably damaging 0.98
R7917:Polq UTSW 16 36,885,650 (GRCm39) missense probably benign 0.08
R7940:Polq UTSW 16 36,881,004 (GRCm39) missense probably benign 0.27
R8028:Polq UTSW 16 36,881,678 (GRCm39) missense possibly damaging 0.82
R8114:Polq UTSW 16 36,862,577 (GRCm39) missense possibly damaging 0.94
R8144:Polq UTSW 16 36,849,846 (GRCm39) missense probably benign 0.01
R8288:Polq UTSW 16 36,848,272 (GRCm39) missense probably damaging 1.00
R8301:Polq UTSW 16 36,882,181 (GRCm39) missense probably damaging 1.00
R8341:Polq UTSW 16 36,892,133 (GRCm39) missense possibly damaging 0.96
R8348:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8448:Polq UTSW 16 36,837,559 (GRCm39) critical splice acceptor site probably null
R8815:Polq UTSW 16 36,853,893 (GRCm39) missense probably damaging 1.00
R8843:Polq UTSW 16 36,832,280 (GRCm39) missense unknown
R8878:Polq UTSW 16 36,860,869 (GRCm39) missense probably benign 0.02
R9016:Polq UTSW 16 36,843,159 (GRCm39) missense probably damaging 1.00
R9189:Polq UTSW 16 36,865,265 (GRCm39) missense probably damaging 1.00
R9209:Polq UTSW 16 36,869,011 (GRCm39) missense possibly damaging 0.94
R9352:Polq UTSW 16 36,862,252 (GRCm39) missense probably damaging 0.98
R9398:Polq UTSW 16 36,881,394 (GRCm39) missense probably benign 0.02
R9403:Polq UTSW 16 36,882,215 (GRCm39) missense probably benign 0.00
R9489:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9605:Polq UTSW 16 36,843,173 (GRCm39) missense probably benign 0.00
R9664:Polq UTSW 16 36,848,176 (GRCm39) missense probably damaging 0.98
R9801:Polq UTSW 16 36,913,190 (GRCm39) missense probably damaging 1.00
X0060:Polq UTSW 16 36,837,599 (GRCm39) nonsense probably null
Z1176:Polq UTSW 16 36,862,619 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCACTCCTTTCTGAAATGAC -3'
(R):5'- TCCTTTGCAGTTCTGGACTTAAG -3'

Sequencing Primer
(F):5'- TCCTTTCTGAAATGACACCAAAC -3'
(R):5'- GTTAAATGATGCTCCTGACCAAGTG -3'
Posted On 2014-06-23