Incidental Mutation 'R1854:Ift140'
ID 205983
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
MMRRC Submission 039878-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1854 (G1)
Quality Score 148
Status Not validated
Chromosome 17
Chromosomal Location 25235056-25318461 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25254813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 162 (F162Y)
Ref Sequence ENSEMBL: ENSMUSP00000116689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]
AlphaFold E9PY46
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: F431Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: F431Y

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
AA Change: F431Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: F431Y

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect probably benign
Transcript: ENSMUST00000156945
AA Change: F162Y

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: F162Y

DomainStartEndE-ValueType
Blast:WD40 2 35 6e-12 BLAST
SCOP:d1erja_ 19 131 5e-7 SMART
Blast:WD40 39 83 1e-24 BLAST
Blast:WD40 95 136 2e-18 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,504,668 (GRCm39) R43K possibly damaging Het
Acp1 A G 12: 30,947,804 (GRCm39) I78T possibly damaging Het
Afap1l1 G T 18: 61,876,365 (GRCm39) D417E probably benign Het
Agap2 G A 10: 126,916,385 (GRCm39) V299I unknown Het
Ahnak C T 19: 8,991,196 (GRCm39) A4160V possibly damaging Het
Anapc1 T C 2: 128,517,810 (GRCm39) E278G probably damaging Het
Atad2 G A 15: 57,960,685 (GRCm39) P971L possibly damaging Het
Atg2a A G 19: 6,302,461 (GRCm39) E928G probably benign Het
Atp2b2 A C 6: 113,819,244 (GRCm39) N16K probably damaging Het
Atp6ap1l T C 13: 91,031,707 (GRCm39) E325G probably damaging Het
Bfsp2 C T 9: 103,327,030 (GRCm39) G236S probably benign Het
Ccar1 A T 10: 62,600,296 (GRCm39) I545N probably damaging Het
Ccser2 A G 14: 36,640,548 (GRCm39) C11R possibly damaging Het
Cdc42bpg A T 19: 6,370,837 (GRCm39) H1310L possibly damaging Het
Ces1h T C 8: 94,085,450 (GRCm39) K339E probably benign Het
Cfap91 T C 16: 38,144,659 (GRCm39) probably null Het
Cit A G 5: 116,011,960 (GRCm39) Y189C probably damaging Het
Cnih3 C A 1: 181,282,186 (GRCm39) S140* probably null Het
Cntrl A G 2: 35,012,696 (GRCm39) D278G probably damaging Het
Col24a1 G A 3: 145,164,895 (GRCm39) G1033D probably damaging Het
Col6a1 T G 10: 76,557,783 (GRCm39) Y151S probably damaging Het
Col6a2 T A 10: 76,450,646 (GRCm39) Q95L probably damaging Het
Cpd G T 11: 76,677,164 (GRCm39) P1185Q probably damaging Het
Cycs T A 6: 50,542,309 (GRCm39) I76F possibly damaging Het
Cyp4f16 T A 17: 32,756,073 (GRCm39) I34N probably damaging Het
Ddx1 A C 12: 13,279,332 (GRCm39) S436A probably benign Het
Defa30 A G 8: 21,625,500 (GRCm39) Y88C probably damaging Het
Dhx30 G A 9: 109,917,740 (GRCm39) L317F probably damaging Het
Dll3 C A 7: 27,995,835 (GRCm39) G322V probably damaging Het
Dnah10 G A 5: 124,881,753 (GRCm39) D2843N probably damaging Het
Dnaja3 C T 16: 4,515,133 (GRCm39) T266I probably damaging Het
Dpp9 T C 17: 56,509,885 (GRCm39) I314V probably benign Het
E030025P04Rik A G 11: 109,034,744 (GRCm39) V48A unknown Het
Enpp2 C T 15: 54,709,219 (GRCm39) E803K probably damaging Het
Eri3 G A 4: 117,506,562 (GRCm39) G297D probably benign Het
Esp34 A G 17: 38,870,424 (GRCm39) E38G possibly damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Frzb A G 2: 80,276,724 (GRCm39) V154A possibly damaging Het
Fsip2 G T 2: 82,823,601 (GRCm39) A6445S possibly damaging Het
Gm11938 G A 11: 99,493,843 (GRCm39) T84I possibly damaging Het
Gm4787 T A 12: 81,425,108 (GRCm39) H350L probably damaging Het
Gpa33 A G 1: 165,992,759 (GRCm39) I291V probably benign Het
Gpr158 A G 2: 21,373,935 (GRCm39) Y290C probably damaging Het
Gpsm1 G T 2: 26,234,725 (GRCm39) G84W probably damaging Het
Hormad1 A G 3: 95,487,317 (GRCm39) N267S probably benign Het
Htr2a A T 14: 74,943,193 (GRCm39) I258F probably damaging Het
Htra4 T C 8: 25,523,597 (GRCm39) T323A probably damaging Het
Islr2 T C 9: 58,107,099 (GRCm39) T54A probably damaging Het
Kcna4 T G 2: 107,126,829 (GRCm39) V521G probably damaging Het
Kdr C T 5: 76,113,565 (GRCm39) G768S possibly damaging Het
Kif6 G T 17: 50,208,799 (GRCm39) A740S probably benign Het
Lad1 T A 1: 135,755,468 (GRCm39) V248E probably damaging Het
Lamb1 T G 12: 31,368,271 (GRCm39) C1134G probably damaging Het
Lamc1 A G 1: 153,125,618 (GRCm39) Y552H probably damaging Het
Mctp1 A T 13: 76,973,860 (GRCm39) T706S probably damaging Het
Med12l A G 3: 59,168,193 (GRCm39) Y1541C probably damaging Het
Mnx1 C T 5: 29,682,780 (GRCm39) S165N unknown Het
Morn3 A T 5: 123,184,692 (GRCm39) probably null Het
Nalcn C T 14: 123,697,824 (GRCm39) R484Q probably damaging Het
Nr4a1 T C 15: 101,169,645 (GRCm39) I305T probably benign Het
Or1j11 C T 2: 36,311,886 (GRCm39) H159Y probably damaging Het
Or2z2 G A 11: 58,346,257 (GRCm39) R173W probably damaging Het
Pabir2 T A X: 52,342,933 (GRCm39) Q201H probably benign Het
Pcdhb5 T C 18: 37,455,393 (GRCm39) V591A possibly damaging Het
Pdia3 T C 2: 121,262,144 (GRCm39) I205T probably benign Het
Pdia4 A T 6: 47,790,161 (GRCm39) D26E unknown Het
Phactr3 C A 2: 177,924,940 (GRCm39) L292M probably damaging Het
Phf21b T A 15: 84,738,963 (GRCm39) I21F probably benign Het
Pign A G 1: 105,482,223 (GRCm39) V791A probably damaging Het
Pitpna A G 11: 75,499,929 (GRCm39) probably null Het
Piwil1 G T 5: 128,824,903 (GRCm39) E534* probably null Het
Plcz1 T A 6: 139,938,775 (GRCm39) I526F probably benign Het
Pms2 A T 5: 143,862,714 (GRCm39) K607I probably benign Het
Pnn T A 12: 59,118,399 (GRCm39) N327K probably damaging Het
Pogz C T 3: 94,786,160 (GRCm39) T863I probably benign Het
Polq C T 16: 36,882,471 (GRCm39) T1545I probably benign Het
Psd4 G A 2: 24,287,468 (GRCm39) E467K probably benign Het
Pstpip2 T A 18: 77,959,499 (GRCm39) L198Q probably damaging Het
Pzp T C 6: 128,479,188 (GRCm39) Y655C probably damaging Het
Qrsl1 C T 10: 43,770,541 (GRCm39) G117E probably damaging Het
Rad54b G A 4: 11,601,669 (GRCm39) C408Y probably damaging Het
Ralb T A 1: 119,403,797 (GRCm39) Q110L possibly damaging Het
Rrm2 A G 12: 24,763,151 (GRCm39) K218E probably damaging Het
Siglece A G 7: 43,309,360 (GRCm39) F66S probably benign Het
Slc17a8 A T 10: 89,442,627 (GRCm39) C69S unknown Het
Slc1a6 T A 10: 78,648,758 (GRCm39) V493E probably damaging Het
Slc38a11 A T 2: 65,193,860 (GRCm39) probably null Het
Smarcal1 G A 1: 72,625,258 (GRCm39) G135D possibly damaging Het
Snrnp70 T A 7: 45,026,644 (GRCm39) R242* probably null Het
St3gal5 T C 6: 72,109,077 (GRCm39) L55P probably damaging Het
Sulf1 A G 1: 12,908,661 (GRCm39) N558S probably benign Het
Supt6 T C 11: 78,123,366 (GRCm39) I104V possibly damaging Het
Tas2r113 T A 6: 132,870,292 (GRCm39) Y107N probably damaging Het
Tcf7 A G 11: 52,147,891 (GRCm39) V187A probably benign Het
Tdrd9 G A 12: 112,011,246 (GRCm39) G1152R probably damaging Het
Tfpi A G 2: 84,288,451 (GRCm39) Y9H probably benign Het
Tnk2 G A 16: 32,498,960 (GRCm39) V758I probably damaging Het
Trim72 A G 7: 127,608,254 (GRCm39) I251V probably benign Het
Trip12 T A 1: 84,705,866 (GRCm39) N655Y probably damaging Het
Ttn A G 2: 76,581,773 (GRCm39) V23040A probably damaging Het
Tulp2 T A 7: 45,167,367 (GRCm39) N188K probably damaging Het
Ube2c C T 2: 164,613,282 (GRCm39) H67Y probably damaging Het
Unc80 C A 1: 66,670,573 (GRCm39) P1899T possibly damaging Het
Usp34 C T 11: 23,376,153 (GRCm39) A1879V probably benign Het
Vmn2r118 G A 17: 55,918,556 (GRCm39) S112L possibly damaging Het
Wdfy3 A T 5: 102,036,052 (GRCm39) V2122E probably benign Het
Zcchc4 A G 5: 52,973,168 (GRCm39) Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,344,701 (GRCm39) probably null Het
Zdhhc25 A T 15: 88,484,689 (GRCm39) H8L probably benign Het
Zfp455 A T 13: 67,355,881 (GRCm39) H383L probably damaging Het
Zfp663 A G 2: 165,195,211 (GRCm39) I336T probably benign Het
Zfp738 T A 13: 67,818,476 (GRCm39) H505L probably damaging Het
Zfp84 T G 7: 29,474,796 (GRCm39) F23V possibly damaging Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25,274,618 (GRCm39) missense probably damaging 1.00
IGL00966:Ift140 APN 17 25,237,776 (GRCm39) missense probably damaging 1.00
IGL01082:Ift140 APN 17 25,267,429 (GRCm39) missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25,313,676 (GRCm39) missense probably benign 0.02
IGL01816:Ift140 APN 17 25,305,999 (GRCm39) splice site probably null
IGL01994:Ift140 APN 17 25,267,417 (GRCm39) missense probably damaging 1.00
IGL02102:Ift140 APN 17 25,252,104 (GRCm39) missense probably benign 0.03
IGL02207:Ift140 APN 17 25,274,572 (GRCm39) missense probably benign
IGL02493:Ift140 APN 17 25,306,898 (GRCm39) nonsense probably null
IGL02735:Ift140 APN 17 25,253,009 (GRCm39) splice site probably benign
IGL02902:Ift140 APN 17 25,309,736 (GRCm39) missense probably damaging 1.00
IGL03037:Ift140 APN 17 25,311,368 (GRCm39) missense probably benign 0.02
IGL03122:Ift140 APN 17 25,305,884 (GRCm39) missense probably damaging 1.00
IGL03206:Ift140 APN 17 25,311,800 (GRCm39) missense probably damaging 0.98
IGL03271:Ift140 APN 17 25,306,880 (GRCm39) missense probably damaging 1.00
IGL03358:Ift140 APN 17 25,306,958 (GRCm39) missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25,305,834 (GRCm39) missense probably damaging 0.98
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0197:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0355:Ift140 UTSW 17 25,267,409 (GRCm39) nonsense probably null
R0399:Ift140 UTSW 17 25,269,314 (GRCm39) missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25,270,734 (GRCm39) splice site probably null
R0610:Ift140 UTSW 17 25,254,777 (GRCm39) missense probably benign 0.06
R0701:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0883:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0900:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R1167:Ift140 UTSW 17 25,254,719 (GRCm39) missense probably benign 0.01
R1295:Ift140 UTSW 17 25,307,907 (GRCm39) critical splice donor site probably null
R1588:Ift140 UTSW 17 25,306,959 (GRCm39) missense probably damaging 1.00
R1619:Ift140 UTSW 17 25,307,839 (GRCm39) missense probably damaging 1.00
R1637:Ift140 UTSW 17 25,244,608 (GRCm39) missense probably benign 0.40
R2397:Ift140 UTSW 17 25,239,710 (GRCm39) missense probably damaging 1.00
R2510:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R2918:Ift140 UTSW 17 25,254,805 (GRCm39) missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R3878:Ift140 UTSW 17 25,247,918 (GRCm39) missense probably benign 0.25
R4559:Ift140 UTSW 17 25,309,741 (GRCm39) missense probably damaging 0.97
R4670:Ift140 UTSW 17 25,317,935 (GRCm39) unclassified probably benign
R4711:Ift140 UTSW 17 25,313,691 (GRCm39) splice site probably null
R4934:Ift140 UTSW 17 25,267,462 (GRCm39) missense probably benign
R4949:Ift140 UTSW 17 25,313,639 (GRCm39) missense probably benign 0.06
R4982:Ift140 UTSW 17 25,255,968 (GRCm39) missense probably damaging 0.99
R5099:Ift140 UTSW 17 25,309,674 (GRCm39) missense probably damaging 1.00
R5223:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R5268:Ift140 UTSW 17 25,239,601 (GRCm39) missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25,252,059 (GRCm39) missense probably damaging 0.96
R5480:Ift140 UTSW 17 25,239,550 (GRCm39) missense probably damaging 1.00
R5655:Ift140 UTSW 17 25,264,038 (GRCm39) missense probably damaging 1.00
R5756:Ift140 UTSW 17 25,247,787 (GRCm39) missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25,308,514 (GRCm39) missense probably damaging 1.00
R5894:Ift140 UTSW 17 25,252,893 (GRCm39) missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25,311,345 (GRCm39) missense probably benign 0.02
R5966:Ift140 UTSW 17 25,313,735 (GRCm39) nonsense probably null
R6000:Ift140 UTSW 17 25,255,934 (GRCm39) missense probably benign 0.00
R6046:Ift140 UTSW 17 25,274,563 (GRCm39) missense probably benign 0.00
R6050:Ift140 UTSW 17 25,309,979 (GRCm39) missense probably damaging 1.00
R6103:Ift140 UTSW 17 25,312,100 (GRCm39) missense probably damaging 1.00
R6239:Ift140 UTSW 17 25,247,946 (GRCm39) missense probably benign 0.26
R6287:Ift140 UTSW 17 25,269,408 (GRCm39) missense probably benign
R6539:Ift140 UTSW 17 25,313,643 (GRCm39) missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25,251,147 (GRCm39) missense probably damaging 0.96
R6723:Ift140 UTSW 17 25,252,090 (GRCm39) missense probably benign 0.08
R6749:Ift140 UTSW 17 25,317,890 (GRCm39) missense probably damaging 0.99
R6892:Ift140 UTSW 17 25,239,520 (GRCm39) missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25,274,699 (GRCm39) missense probably damaging 1.00
R7235:Ift140 UTSW 17 25,239,619 (GRCm39) missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25,256,010 (GRCm39) missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25,252,089 (GRCm39) missense probably benign 0.02
R7560:Ift140 UTSW 17 25,311,315 (GRCm39) missense probably benign 0.28
R7660:Ift140 UTSW 17 25,270,798 (GRCm39) missense probably damaging 1.00
R8105:Ift140 UTSW 17 25,255,949 (GRCm39) missense probably benign 0.01
R8415:Ift140 UTSW 17 25,311,889 (GRCm39) missense probably damaging 0.99
R8437:Ift140 UTSW 17 25,313,651 (GRCm39) missense probably damaging 0.99
R8747:Ift140 UTSW 17 25,254,809 (GRCm39) missense probably benign
R8932:Ift140 UTSW 17 25,305,862 (GRCm39) missense probably benign 0.03
R9226:Ift140 UTSW 17 25,317,839 (GRCm39) missense probably benign 0.00
R9347:Ift140 UTSW 17 25,313,753 (GRCm39) missense probably benign 0.00
R9451:Ift140 UTSW 17 25,252,925 (GRCm39) missense probably benign 0.33
R9456:Ift140 UTSW 17 25,254,758 (GRCm39) missense probably benign 0.03
R9782:Ift140 UTSW 17 25,264,151 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGGCATCTAAATACTTCCTGCC -3'
(R):5'- TGAGAATGGATTAAGCTGCCTCC -3'

Sequencing Primer
(F):5'- GCATCTAAATACTTCCTGCCTGTGTC -3'
(R):5'- GAATGGATTAAGCTGCCTCCAAGTC -3'
Posted On 2014-06-23