Mutagenetix > Incidental Mutations

Incidental Mutation 'R1854:Ift140'

205983

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

039878-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1854 (G1)

Quality Score

148

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25035839 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 162 (F162Y)

Ref Sequence

ENSEMBL: ENSMUSP00000116689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: F431Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: F431Y

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: F431Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: F431Y

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

probably benign
Transcript: ENSMUST00000156945
AA Change: F162Y

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: F162Y

Domain	Start	End	E-Value	Type
Blast:WD40	2	35	6e-12	BLAST
SCOP:d1erja_	19	131	5e-7	SMART
Blast:WD40	39	83	1e-24	BLAST
Blast:WD40	95	136	2e-18	BLAST

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	T	16: 88,707,780	R43K	possibly damaging	Het
Acp1	A	G	12: 30,897,805	I78T	possibly damaging	Het
Afap1l1	G	T	18: 61,743,294	D417E	probably benign	Het
Agap2	G	A	10: 127,080,516	V299I	unknown	Het
Ahnak	C	T	19: 9,013,832	A4160V	possibly damaging	Het
Anapc1	T	C	2: 128,675,890	E278G	probably damaging	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
Atg2a	A	G	19: 6,252,431	E928G	probably benign	Het
Atp2b2	A	C	6: 113,842,283	N16K	probably damaging	Het
Atp6ap1l	T	C	13: 90,883,588	E325G	probably damaging	Het
Bfsp2	C	T	9: 103,449,831	G236S	probably benign	Het
Ccar1	A	T	10: 62,764,517	I545N	probably damaging	Het
Ccser2	A	G	14: 36,918,591	C11R	possibly damaging	Het
Cdc42bpg	A	T	19: 6,320,807	H1310L	possibly damaging	Het
Ces1h	T	C	8: 93,358,822	K339E	probably benign	Het
Cit	A	G	5: 115,873,901	Y189C	probably damaging	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Cntrl	A	G	2: 35,122,684	D278G	probably damaging	Het
Col24a1	G	A	3: 145,459,140	G1033D	probably damaging	Het
Col6a1	T	G	10: 76,721,949	Y151S	probably damaging	Het
Col6a2	T	A	10: 76,614,812	Q95L	probably damaging	Het
Cpd	G	T	11: 76,786,338	P1185Q	probably damaging	Het
Cycs	T	A	6: 50,565,329	I76F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,099	I34N	probably damaging	Het
Ddx1	A	C	12: 13,229,331	S436A	probably benign	Het
Defa30	A	G	8: 21,135,484	Y88C	probably damaging	Het
Dhx30	G	A	9: 110,088,672	L317F	probably damaging	Het
Dll3	C	A	7: 28,296,410	G322V	probably damaging	Het
Dnah10	G	A	5: 124,804,689	D2843N	probably damaging	Het
Dnaja3	C	T	16: 4,697,269	T266I	probably damaging	Het
Dpp9	T	C	17: 56,202,885	I314V	probably benign	Het
E030025P04Rik	A	G	11: 109,143,918	V48A	unknown	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Eri3	G	A	4: 117,649,365	G297D	probably benign	Het
Esp34	A	G	17: 38,559,533	E38G	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Frzb	A	G	2: 80,446,380	V154A	possibly damaging	Het
Fsip2	G	T	2: 82,993,257	A6445S	possibly damaging	Het
Gm11938	G	A	11: 99,603,017	T84I	possibly damaging	Het
Gm4787	T	A	12: 81,378,334	H350L	probably damaging	Het
Gpa33	A	G	1: 166,165,190	I291V	probably benign	Het
Gpr158	A	G	2: 21,369,124	Y290C	probably damaging	Het
Gpsm1	G	T	2: 26,344,713	G84W	probably damaging	Het
Hormad1	A	G	3: 95,580,006	N267S	probably benign	Het
Htr2a	A	T	14: 74,705,753	I258F	probably damaging	Het
Htra4	T	C	8: 25,033,581	T323A	probably damaging	Het
Islr2	T	C	9: 58,199,816	T54A	probably damaging	Het
Kcna4	T	G	2: 107,296,484	V521G	probably damaging	Het
Kdr	C	T	5: 75,952,905	G768S	possibly damaging	Het
Kif6	G	T	17: 49,901,771	A740S	probably benign	Het
Lad1	T	A	1: 135,827,730	V248E	probably damaging	Het
Lamb1	T	G	12: 31,318,272	C1134G	probably damaging	Het
Lamc1	A	G	1: 153,249,872	Y552H	probably damaging	Het
Maats1	T	C	16: 38,324,297		probably null	Het
Mctp1	A	T	13: 76,825,741	T706S	probably damaging	Het
Med12l	A	G	3: 59,260,772	Y1541C	probably damaging	Het
Mnx1	C	T	5: 29,477,782	S165N	unknown	Het
Morn3	A	T	5: 123,046,629		probably null	Het
Nalcn	C	T	14: 123,460,412	R484Q	probably damaging	Het
Nr4a1	T	C	15: 101,271,764	I305T	probably benign	Het
Olfr30	G	A	11: 58,455,431	R173W	probably damaging	Het
Olfr339	C	T	2: 36,421,874	H159Y	probably damaging	Het
Pcdhb5	T	C	18: 37,322,340	V591A	possibly damaging	Het
Pdia3	T	C	2: 121,431,663	I205T	probably benign	Het
Pdia4	A	T	6: 47,813,227	D26E	unknown	Het
Phactr3	C	A	2: 178,283,147	L292M	probably damaging	Het
Phf21b	T	A	15: 84,854,762	I21F	probably benign	Het
Pign	A	G	1: 105,554,498	V791A	probably damaging	Het
Pitpna	A	G	11: 75,609,103		probably null	Het
Piwil1	G	T	5: 128,747,839	E534*	probably null	Het
Plcz1	T	A	6: 139,993,049	I526F	probably benign	Het
Pms2	A	T	5: 143,925,896	K607I	probably benign	Het
Pnn	T	A	12: 59,071,613	N327K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Polq	C	T	16: 37,062,109	T1545I	probably benign	Het
Psd4	G	A	2: 24,397,456	E467K	probably benign	Het
Pstpip2	T	A	18: 77,871,799	L198Q	probably damaging	Het
Pzp	T	C	6: 128,502,225	Y655C	probably damaging	Het
Qrsl1	C	T	10: 43,894,545	G117E	probably damaging	Het
Rad54b	G	A	4: 11,601,669	C408Y	probably damaging	Het
Ralb	T	A	1: 119,476,067	Q110L	possibly damaging	Het
Rrm2	A	G	12: 24,713,152	K218E	probably damaging	Het
Siglece	A	G	7: 43,659,936	F66S	probably benign	Het
Slc17a8	A	T	10: 89,606,765	C69S	unknown	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc38a11	A	T	2: 65,363,516		probably null	Het
Smarcal1	G	A	1: 72,586,099	G135D	possibly damaging	Het
Snrnp70	T	A	7: 45,377,220	R242*	probably null	Het
St3gal5	T	C	6: 72,132,093	L55P	probably damaging	Het
Sulf1	A	G	1: 12,838,437	N558S	probably benign	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tas2r113	T	A	6: 132,893,329	Y107N	probably damaging	Het
Tcf7	A	G	11: 52,257,064	V187A	probably benign	Het
Tdrd9	G	A	12: 112,044,812	G1152R	probably damaging	Het
Tfpi	A	G	2: 84,458,107	Y9H	probably benign	Het
Tnk2	G	A	16: 32,680,142	V758I	probably damaging	Het
Trim72	A	G	7: 128,009,082	I251V	probably benign	Het
Trip12	T	A	1: 84,728,145	N655Y	probably damaging	Het
Ttn	A	G	2: 76,751,429	V23040A	probably damaging	Het
Tulp2	T	A	7: 45,517,943	N188K	probably damaging	Het
Ube2c	C	T	2: 164,771,362	H67Y	probably damaging	Het
Unc80	C	A	1: 66,631,414	P1899T	possibly damaging	Het
Usp34	C	T	11: 23,426,153	A1879V	probably benign	Het
Vmn2r118	G	A	17: 55,611,556	S112L	possibly damaging	Het
Wdfy3	A	T	5: 101,888,186	V2122E	probably benign	Het
Zcchc4	A	G	5: 52,815,826	Y344C	probably damaging	Het
Zdbf2	GAAAAA	GAAAAAA	1: 63,305,542		probably null	Het
Zdhhc25	A	T	15: 88,600,486	H8L	probably benign	Het
Zfp455	A	T	13: 67,207,817	H383L	probably damaging	Het
Zfp663	A	G	2: 165,353,291	I336T	probably benign	Het
Zfp738	T	A	13: 67,670,357	H505L	probably damaging	Het
Zfp84	T	G	7: 29,775,371	F23V	possibly damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGGCATCTAAATACTTCCTGCC -3'
(R):5'- TGAGAATGGATTAAGCTGCCTCC -3'

Sequencing Primer
(F):5'- GCATCTAAATACTTCCTGCCTGTGTC -3'
(R):5'- GAATGGATTAAGCTGCCTCCAAGTC -3'

Posted On

2014-06-23