Incidental Mutation 'R0113:Aspscr1'
ID 20600
Institutional Source Beutler Lab
Gene Symbol Aspscr1
Ensembl Gene ENSMUSG00000025142
Gene Name alveolar soft part sarcoma chromosome region, candidate 1 (human)
Synonyms ASPCR1, RCC17, TUG, ASPC, ASPL, 1190006K01Rik
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0113 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 120672973-120709447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 120688925 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 97 (Q97E)
Ref Sequence ENSEMBL: ENSMUSP00000101766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026135] [ENSMUST00000103016] [ENSMUST00000106158] [ENSMUST00000106159] [ENSMUST00000106160] [ENSMUST00000131727] [ENSMUST00000135346] [ENSMUST00000143844] [ENSMUST00000149389] [ENSMUST00000151160] [ENSMUST00000153346] [ENSMUST00000168510] [ENSMUST00000168714] [ENSMUST00000168097]
AlphaFold Q8VBT9
Predicted Effect probably benign
Transcript: ENSMUST00000026135
AA Change: Q174E

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026135
Gene: ENSMUSG00000025142
AA Change: Q174E

DomainStartEndE-ValueType
Pfam:TUG-UBL1 15 78 1.4e-29 PFAM
low complexity region 193 206 N/A INTRINSIC
low complexity region 284 313 N/A INTRINSIC
coiled coil region 339 365 N/A INTRINSIC
UBX 378 459 1.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103016
AA Change: Q97E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099305
Gene: ENSMUSG00000025142
AA Change: Q97E

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106158
AA Change: Q97E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101764
Gene: ENSMUSG00000025142
AA Change: Q97E

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106159
AA Change: Q97E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101765
Gene: ENSMUSG00000025142
AA Change: Q97E

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106160
AA Change: Q97E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101766
Gene: ENSMUSG00000025142
AA Change: Q97E

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131727
AA Change: Q97E

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117654
Gene: ENSMUSG00000025142
AA Change: Q97E

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135346
AA Change: Q97E

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120072
Gene: ENSMUSG00000025142
AA Change: Q97E

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143844
Predicted Effect probably benign
Transcript: ENSMUST00000149389
AA Change: Q159E

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122216
Gene: ENSMUSG00000025142
AA Change: Q159E

DomainStartEndE-ValueType
Pfam:TUG-UBL1 3 63 3.7e-24 PFAM
low complexity region 178 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151160
AA Change: Q97E

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116447
Gene: ENSMUSG00000025142
AA Change: Q97E

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163273
Predicted Effect probably benign
Transcript: ENSMUST00000166838
SMART Domains Protein: ENSMUSP00000127202
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
coiled coil region 49 75 N/A INTRINSIC
Blast:UBX 89 119 7e-13 BLAST
SCOP:d1i42a_ 92 119 4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168510
AA Change: Q33E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125931
Gene: ENSMUSG00000025142
AA Change: Q33E

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168714
SMART Domains Protein: ENSMUSP00000129462
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
SCOP:d1h8ca_ 12 82 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168097
Predicted Effect probably benign
Transcript: ENSMUST00000167678
SMART Domains Protein: ENSMUSP00000128940
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
coiled coil region 37 63 N/A INTRINSIC
Blast:UBX 77 107 8e-13 BLAST
SCOP:d1i42a_ 80 107 5e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X;17)(p11;q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in Aspscr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02588:Aspscr1 APN 11 120677531 missense possibly damaging 0.93
IGL02683:Aspscr1 APN 11 120701226 missense probably damaging 1.00
IGL02719:Aspscr1 APN 11 120677579 missense probably damaging 1.00
I1329:Aspscr1 UTSW 11 120701240 missense probably damaging 0.99
R0277:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0323:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0457:Aspscr1 UTSW 11 120677618 missense probably benign 0.35
R0714:Aspscr1 UTSW 11 120703667 critical splice donor site probably null
R1435:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R1509:Aspscr1 UTSW 11 120701516 missense probably damaging 1.00
R1739:Aspscr1 UTSW 11 120678516 missense probably damaging 1.00
R1789:Aspscr1 UTSW 11 120688560 missense probably damaging 1.00
R1958:Aspscr1 UTSW 11 120689208 missense probably null 1.00
R2414:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R2432:Aspscr1 UTSW 11 120702566 intron probably benign
R4059:Aspscr1 UTSW 11 120686679 missense probably benign 0.22
R4159:Aspscr1 UTSW 11 120708676 missense probably damaging 1.00
R4703:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4705:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4748:Aspscr1 UTSW 11 120701507 missense probably damaging 0.99
R5141:Aspscr1 UTSW 11 120689177 missense probably benign 0.01
R5869:Aspscr1 UTSW 11 120688920 missense possibly damaging 0.55
R7543:Aspscr1 UTSW 11 120709423 missense unknown
R7555:Aspscr1 UTSW 11 120673100 missense unknown
R7609:Aspscr1 UTSW 11 120677522 missense probably damaging 0.99
R7670:Aspscr1 UTSW 11 120689039 missense probably benign 0.00
R7946:Aspscr1 UTSW 11 120708617 missense
R7999:Aspscr1 UTSW 11 120678522 critical splice donor site probably null
R8299:Aspscr1 UTSW 11 120709074 missense
Predicted Primers PCR Primer
(F):5'- TGCCTTCAAGGACTACTCCTTCCAG -3'
(R):5'- ACTACTCTCGGTAGCACAGACTCG -3'

Sequencing Primer
(F):5'- GACTACTCCTTCCAGCCATTTTTC -3'
(R):5'- TGGACAAGCACTGCCATAG -3'
Posted On 2013-04-11