Incidental Mutation 'R1855:Pikfyve'
ID206000
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Namephosphoinositide kinase, FYVE type zinc finger containing
SynonymsPip5k3
MMRRC Submission 039879-MU
Accession Numbers

Genbank: NM_011086

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1855 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65186683-65278695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65258798 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1562 (T1562K)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
Predicted Effect probably benign
Transcript: ENSMUST00000081154
AA Change: T1517K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: T1517K

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: T1562K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: T1562K

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,747,971 L285Q probably damaging Het
Acaca T C 11: 84,371,554 L1994P probably damaging Het
Adamts9 A G 6: 92,901,369 probably benign Het
Aff3 T C 1: 38,210,304 E574G probably benign Het
Ankrd1 T C 19: 36,119,235 K64R probably damaging Het
Arhgap23 T C 11: 97,448,697 I163T probably damaging Het
Ascc3 A T 10: 50,617,922 Q151L probably benign Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
C1s1 A C 6: 124,534,356 probably null Het
Ccdc150 T C 1: 54,367,910 probably benign Het
Cdhr3 A T 12: 33,060,352 I311N probably damaging Het
Chad T A 11: 94,565,477 L127H probably damaging Het
Clasp1 G A 1: 118,508,894 A303T probably damaging Het
Clptm1 A G 7: 19,638,209 V234A probably benign Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Csnk1a1 T A 18: 61,575,427 probably null Het
Cttnbp2 T A 6: 18,378,413 I1475L probably benign Het
Dnah5 T C 15: 28,411,669 V3728A possibly damaging Het
Dock9 C A 14: 121,640,159 V391F probably damaging Het
Ehmt2 A T 17: 34,910,776 I949F probably damaging Het
Eif4g1 C A 16: 20,687,161 T1025K possibly damaging Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Esrrg A T 1: 188,211,098 M423L probably damaging Het
Etnppl A T 3: 130,620,722 I89F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Fbln7 A G 2: 128,893,835 T248A possibly damaging Het
Galnt9 C T 5: 110,615,524 T465M probably damaging Het
Grcc10 A G 6: 124,740,578 V57A probably benign Het
Herc1 T A 9: 66,391,426 M614K possibly damaging Het
Itch C T 2: 155,172,454 probably benign Het
Kdm6b C A 11: 69,407,286 A167S probably damaging Het
Kidins220 C T 12: 25,056,591 R1348C probably damaging Het
Kif17 T C 4: 138,288,271 L577P probably benign Het
Krt25 A T 11: 99,318,315 L258Q probably damaging Het
March10 T C 11: 105,390,392 T356A probably benign Het
Mical2 G A 7: 112,345,282 A940T probably benign Het
Mrpl4 A G 9: 21,003,371 E81G possibly damaging Het
Mtcl1 A G 17: 66,379,514 V447A probably benign Het
Mtor C A 4: 148,553,089 N2502K probably benign Het
Notch4 G A 17: 34,580,962 D966N probably benign Het
Oip5 C A 2: 119,611,790 K214N probably benign Het
Olfr160 A T 9: 37,711,970 F103Y possibly damaging Het
Pak7 A T 2: 136,087,509 S585T probably benign Het
Pard3 T A 8: 127,447,812 probably null Het
Pcnx2 A T 8: 125,807,996 probably benign Het
Pcsk5 T C 19: 17,515,192 Y939C possibly damaging Het
Pde1a A G 2: 79,898,064 probably null Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Plekhg6 A T 6: 125,375,839 M115K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ppp1r3a A T 6: 14,754,994 W85R probably damaging Het
Rnf123 C A 9: 108,061,791 R826L probably damaging Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc22a2 A G 17: 12,586,812 D150G probably damaging Het
Snap47 C T 11: 59,428,333 probably benign Het
Spata22 A G 11: 73,340,559 D213G probably benign Het
St6galnac2 T A 11: 116,690,315 R60S probably benign Het
Stk32c A G 7: 139,121,447 F263S probably damaging Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tex2 T C 11: 106,546,876 E158G possibly damaging Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Trim25 C T 11: 89,015,581 T410I probably benign Het
Usp18 T A 6: 121,262,117 C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 Y169C probably damaging Het
Wdr33 A T 18: 31,906,856 probably benign Het
Xpr1 A G 1: 155,283,256 Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,793,990 probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp566 T G 7: 30,078,502 S85R probably benign Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGATACAGTTTTGTCACCAAG -3'
(R):5'- GGAACGAATGGAAGGCTTTGTTTAC -3'

Sequencing Primer
(F):5'- ACAGTTTTGTCACCAAGATTTGG -3'
(R):5'- ATGCTTCACTGGGATCCAAG -3'
Posted On2014-06-23