Mutagenetix > Incidental Mutation

Incidental Mutation 'R1855:Pikfyve'

206000

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

039879-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1855 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 65258798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1562 (T1562K)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

probably benign
Transcript: ENSMUST00000081154
AA Change: T1517K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: T1517K

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097707
AA Change: T1562K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: T1562K

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Meta Mutation Damage Score

0.0715

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	T	A	1: 11,747,971	L285Q	probably damaging	Het
Acaca	T	C	11: 84,371,554	L1994P	probably damaging	Het
Adamts9	A	G	6: 92,901,369		probably benign	Het
Aff3	T	C	1: 38,210,304	E574G	probably benign	Het
Ankrd1	T	C	19: 36,119,235	K64R	probably damaging	Het
Arhgap23	T	C	11: 97,448,697	I163T	probably damaging	Het
Ascc3	A	T	10: 50,617,922	Q151L	probably benign	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
C1s1	A	C	6: 124,534,356		probably null	Het
Ccdc150	T	C	1: 54,367,910		probably benign	Het
Cdhr3	A	T	12: 33,060,352	I311N	probably damaging	Het
Chad	T	A	11: 94,565,477	L127H	probably damaging	Het
Clasp1	G	A	1: 118,508,894	A303T	probably damaging	Het
Clptm1	A	G	7: 19,638,209	V234A	probably benign	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Col24a1	G	A	3: 145,459,140	G1033D	probably damaging	Het
Csnk1a1	T	A	18: 61,575,427		probably null	Het
Cttnbp2	T	A	6: 18,378,413	I1475L	probably benign	Het
Dnah5	T	C	15: 28,411,669	V3728A	possibly damaging	Het
Dock9	C	A	14: 121,640,159	V391F	probably damaging	Het
Ehmt2	A	T	17: 34,910,776	I949F	probably damaging	Het
Eif4g1	C	A	16: 20,687,161	T1025K	possibly damaging	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Esrrg	A	T	1: 188,211,098	M423L	probably damaging	Het
Etnppl	A	T	3: 130,620,722	I89F	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Fbln7	A	G	2: 128,893,835	T248A	possibly damaging	Het
Galnt9	C	T	5: 110,615,524	T465M	probably damaging	Het
Grcc10	A	G	6: 124,740,578	V57A	probably benign	Het
Herc1	T	A	9: 66,391,426	M614K	possibly damaging	Het
Itch	C	T	2: 155,172,454		probably benign	Het
Kdm6b	C	A	11: 69,407,286	A167S	probably damaging	Het
Kidins220	C	T	12: 25,056,591	R1348C	probably damaging	Het
Kif17	T	C	4: 138,288,271	L577P	probably benign	Het
Krt25	A	T	11: 99,318,315	L258Q	probably damaging	Het
March10	T	C	11: 105,390,392	T356A	probably benign	Het
Mical2	G	A	7: 112,345,282	A940T	probably benign	Het
Mrpl4	A	G	9: 21,003,371	E81G	possibly damaging	Het
Mtcl1	A	G	17: 66,379,514	V447A	probably benign	Het
Mtor	C	A	4: 148,553,089	N2502K	probably benign	Het
Notch4	G	A	17: 34,580,962	D966N	probably benign	Het
Oip5	C	A	2: 119,611,790	K214N	probably benign	Het
Olfr160	A	T	9: 37,711,970	F103Y	possibly damaging	Het
Pak7	A	T	2: 136,087,509	S585T	probably benign	Het
Pard3	T	A	8: 127,447,812		probably null	Het
Pcnx2	A	T	8: 125,807,996		probably benign	Het
Pcsk5	T	C	19: 17,515,192	Y939C	possibly damaging	Het
Pde1a	A	G	2: 79,898,064		probably null	Het
Pde9a	C	T	17: 31,455,120	P60S	probably damaging	Het
Plekhg6	A	T	6: 125,375,839	M115K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Ppp1r3a	A	T	6: 14,754,994	W85R	probably damaging	Het
Rnf123	C	A	9: 108,061,791	R826L	probably damaging	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc22a2	A	G	17: 12,586,812	D150G	probably damaging	Het
Snap47	C	T	11: 59,428,333		probably benign	Het
Spata22	A	G	11: 73,340,559	D213G	probably benign	Het
St6galnac2	T	A	11: 116,690,315	R60S	probably benign	Het
Stk32c	A	G	7: 139,121,447	F263S	probably damaging	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tex2	T	C	11: 106,546,876	E158G	possibly damaging	Het
Tiam2	C	T	17: 3,415,135	R380C	probably damaging	Het
Trim25	C	T	11: 89,015,581	T410I	probably benign	Het
Usp18	T	A	6: 121,262,117	C212S	probably benign	Het
Vmn1r2	A	G	4: 3,172,588	Y169C	probably damaging	Het
Wdr33	A	T	18: 31,906,856		probably benign	Het
Xpr1	A	G	1: 155,283,256	Y597H	probably benign	Het
Yy1	CGGG	CGGGGGGGGG	12: 108,793,990		probably benign	Het
Zfp54	T	A	17: 21,434,142	Y299*	probably null	Het
Zfp566	T	G	7: 30,078,502	S85R	probably benign	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGATACAGTTTTGTCACCAAG -3'
(R):5'- GGAACGAATGGAAGGCTTTGTTTAC -3'

Sequencing Primer
(F):5'- ACAGTTTTGTCACCAAGATTTGG -3'
(R):5'- ATGCTTCACTGGGATCCAAG -3'

Posted On

2014-06-23