Incidental Mutation 'R1855:Cttnbp2'
ID206019
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 039879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1855 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18378413 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1475 (I1475L)
Ref Sequence ENSEMBL: ENSMUSP00000088089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000148602]
Predicted Effect probably benign
Transcript: ENSMUST00000090601
AA Change: I1475L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: I1475L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000146775
AA Change: I965L
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: I965L

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148602
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152499
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,747,971 L285Q probably damaging Het
Acaca T C 11: 84,371,554 L1994P probably damaging Het
Adamts9 A G 6: 92,901,369 probably benign Het
Aff3 T C 1: 38,210,304 E574G probably benign Het
Ankrd1 T C 19: 36,119,235 K64R probably damaging Het
Arhgap23 T C 11: 97,448,697 I163T probably damaging Het
Ascc3 A T 10: 50,617,922 Q151L probably benign Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
C1s1 A C 6: 124,534,356 probably null Het
Ccdc150 T C 1: 54,367,910 probably benign Het
Cdhr3 A T 12: 33,060,352 I311N probably damaging Het
Chad T A 11: 94,565,477 L127H probably damaging Het
Clasp1 G A 1: 118,508,894 A303T probably damaging Het
Clptm1 A G 7: 19,638,209 V234A probably benign Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Csnk1a1 T A 18: 61,575,427 probably null Het
Dnah5 T C 15: 28,411,669 V3728A possibly damaging Het
Dock9 C A 14: 121,640,159 V391F probably damaging Het
Ehmt2 A T 17: 34,910,776 I949F probably damaging Het
Eif4g1 C A 16: 20,687,161 T1025K possibly damaging Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Esrrg A T 1: 188,211,098 M423L probably damaging Het
Etnppl A T 3: 130,620,722 I89F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Fbln7 A G 2: 128,893,835 T248A possibly damaging Het
Galnt9 C T 5: 110,615,524 T465M probably damaging Het
Grcc10 A G 6: 124,740,578 V57A probably benign Het
Herc1 T A 9: 66,391,426 M614K possibly damaging Het
Itch C T 2: 155,172,454 probably benign Het
Kdm6b C A 11: 69,407,286 A167S probably damaging Het
Kidins220 C T 12: 25,056,591 R1348C probably damaging Het
Kif17 T C 4: 138,288,271 L577P probably benign Het
Krt25 A T 11: 99,318,315 L258Q probably damaging Het
March10 T C 11: 105,390,392 T356A probably benign Het
Mical2 G A 7: 112,345,282 A940T probably benign Het
Mrpl4 A G 9: 21,003,371 E81G possibly damaging Het
Mtcl1 A G 17: 66,379,514 V447A probably benign Het
Mtor C A 4: 148,553,089 N2502K probably benign Het
Notch4 G A 17: 34,580,962 D966N probably benign Het
Oip5 C A 2: 119,611,790 K214N probably benign Het
Olfr160 A T 9: 37,711,970 F103Y possibly damaging Het
Pak7 A T 2: 136,087,509 S585T probably benign Het
Pard3 T A 8: 127,447,812 probably null Het
Pcnx2 A T 8: 125,807,996 probably benign Het
Pcsk5 T C 19: 17,515,192 Y939C possibly damaging Het
Pde1a A G 2: 79,898,064 probably null Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pikfyve C A 1: 65,258,798 T1562K probably benign Het
Plekhg6 A T 6: 125,375,839 M115K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ppp1r3a A T 6: 14,754,994 W85R probably damaging Het
Rnf123 C A 9: 108,061,791 R826L probably damaging Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc22a2 A G 17: 12,586,812 D150G probably damaging Het
Snap47 C T 11: 59,428,333 probably benign Het
Spata22 A G 11: 73,340,559 D213G probably benign Het
St6galnac2 T A 11: 116,690,315 R60S probably benign Het
Stk32c A G 7: 139,121,447 F263S probably damaging Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tex2 T C 11: 106,546,876 E158G possibly damaging Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Trim25 C T 11: 89,015,581 T410I probably benign Het
Usp18 T A 6: 121,262,117 C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 Y169C probably damaging Het
Wdr33 A T 18: 31,906,856 probably benign Het
Xpr1 A G 1: 155,283,256 Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,793,990 probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp566 T G 7: 30,078,502 S85R probably benign Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
R7353:Cttnbp2 UTSW 6 18375944 missense possibly damaging 0.94
R7465:Cttnbp2 UTSW 6 18501992 missense probably damaging 1.00
R7500:Cttnbp2 UTSW 6 18378420 missense probably benign 0.00
R7534:Cttnbp2 UTSW 6 18420765 critical splice donor site probably null
R7646:Cttnbp2 UTSW 6 18375940 missense probably damaging 1.00
R7678:Cttnbp2 UTSW 6 18382810 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAAGCTGCACAAAATAATGTTAAC -3'
(R):5'- ACTGAGTGTATGGGCCATTTATAAA -3'

Sequencing Primer
(F):5'- CTCAAGTTTTCTGTGATGTAA -3'
(R):5'- GGCATTTATAAAAACCAATGGCAG -3'
Posted On2014-06-23