Incidental Mutation 'R1855:Rnf123'
ID 206034
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 039879-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R1855 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 107938990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 826 (R826L)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000178267] [ENSMUST00000162355] [ENSMUST00000162753]
AlphaFold Q5XPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: R826L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: R826L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: R820L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: R820L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: R820L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: R820L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: R820L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: R820L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: R826L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: R826L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Meta Mutation Damage Score 0.4834 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,818,195 (GRCm39) L285Q probably damaging Het
Acaca T C 11: 84,262,380 (GRCm39) L1994P probably damaging Het
Adamts9 A G 6: 92,878,350 (GRCm39) probably benign Het
Aff3 T C 1: 38,249,385 (GRCm39) E574G probably benign Het
Ankrd1 T C 19: 36,096,635 (GRCm39) K64R probably damaging Het
Arhgap23 T C 11: 97,339,523 (GRCm39) I163T probably damaging Het
Ascc3 A T 10: 50,494,018 (GRCm39) Q151L probably benign Het
Atad2 G A 15: 57,960,685 (GRCm39) P971L possibly damaging Het
C1s1 A C 6: 124,511,315 (GRCm39) probably null Het
Ccdc150 T C 1: 54,407,069 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,351 (GRCm39) I311N probably damaging Het
Chad T A 11: 94,456,303 (GRCm39) L127H probably damaging Het
Clasp1 G A 1: 118,436,624 (GRCm39) A303T probably damaging Het
Clptm1 A G 7: 19,372,134 (GRCm39) V234A probably benign Het
Cnih3 C A 1: 181,282,186 (GRCm39) S140* probably null Het
Col24a1 G A 3: 145,164,895 (GRCm39) G1033D probably damaging Het
Csnk1a1 T A 18: 61,708,498 (GRCm39) probably null Het
Cttnbp2 T A 6: 18,378,412 (GRCm39) I1475L probably benign Het
Dnah5 T C 15: 28,411,815 (GRCm39) V3728A possibly damaging Het
Dock9 C A 14: 121,877,571 (GRCm39) V391F probably damaging Het
Ehmt2 A T 17: 35,129,752 (GRCm39) I949F probably damaging Het
Eif4g1 C A 16: 20,505,911 (GRCm39) T1025K possibly damaging Het
Enpp2 C T 15: 54,709,219 (GRCm39) E803K probably damaging Het
Esrrg A T 1: 187,943,295 (GRCm39) M423L probably damaging Het
Etnppl A T 3: 130,414,371 (GRCm39) I89F probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fbln7 A G 2: 128,735,755 (GRCm39) T248A possibly damaging Het
Galnt9 C T 5: 110,763,390 (GRCm39) T465M probably damaging Het
Grcc10 A G 6: 124,717,541 (GRCm39) V57A probably benign Het
Herc1 T A 9: 66,298,708 (GRCm39) M614K possibly damaging Het
Itch C T 2: 155,014,374 (GRCm39) probably benign Het
Kdm6b C A 11: 69,298,112 (GRCm39) A167S probably damaging Het
Kidins220 C T 12: 25,106,590 (GRCm39) R1348C probably damaging Het
Kif17 T C 4: 138,015,582 (GRCm39) L577P probably benign Het
Krt25 A T 11: 99,209,141 (GRCm39) L258Q probably damaging Het
Marchf10 T C 11: 105,281,218 (GRCm39) T356A probably benign Het
Mical2 G A 7: 111,944,489 (GRCm39) A940T probably benign Het
Mrpl4 A G 9: 20,914,667 (GRCm39) E81G possibly damaging Het
Mtcl1 A G 17: 66,686,509 (GRCm39) V447A probably benign Het
Mtor C A 4: 148,637,546 (GRCm39) N2502K probably benign Het
Notch4 G A 17: 34,799,936 (GRCm39) D966N probably benign Het
Oip5 C A 2: 119,442,271 (GRCm39) K214N probably benign Het
Or8a1b A T 9: 37,623,266 (GRCm39) F103Y possibly damaging Het
Pabir2 T A X: 52,342,933 (GRCm39) Q201H probably benign Het
Pak5 A T 2: 135,929,429 (GRCm39) S585T probably benign Het
Pard3 T A 8: 128,174,293 (GRCm39) probably null Het
Pcnx2 A T 8: 126,534,735 (GRCm39) probably benign Het
Pcsk5 T C 19: 17,492,556 (GRCm39) Y939C possibly damaging Het
Pde1a A G 2: 79,728,408 (GRCm39) probably null Het
Pde9a C T 17: 31,674,094 (GRCm39) P60S probably damaging Het
Pikfyve C A 1: 65,297,957 (GRCm39) T1562K probably benign Het
Plekhg6 A T 6: 125,352,802 (GRCm39) M115K probably damaging Het
Pogz C T 3: 94,786,160 (GRCm39) T863I probably benign Het
Ppp1r3a A T 6: 14,754,993 (GRCm39) W85R probably damaging Het
Slc1a6 T A 10: 78,648,758 (GRCm39) V493E probably damaging Het
Slc22a2 A G 17: 12,805,699 (GRCm39) D150G probably damaging Het
Snap47 C T 11: 59,319,159 (GRCm39) probably benign Het
Spata22 A G 11: 73,231,385 (GRCm39) D213G probably benign Het
St6galnac2 T A 11: 116,581,141 (GRCm39) R60S probably benign Het
Stk32c A G 7: 138,701,363 (GRCm39) F263S probably damaging Het
Supt6 T C 11: 78,123,366 (GRCm39) I104V possibly damaging Het
Tex2 T C 11: 106,437,702 (GRCm39) E158G possibly damaging Het
Tiam2 C T 17: 3,465,410 (GRCm39) R380C probably damaging Het
Trim25 C T 11: 88,906,407 (GRCm39) T410I probably benign Het
Usp18 T A 6: 121,239,076 (GRCm39) C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 (GRCm39) Y169C probably damaging Het
Wdr33 A T 18: 32,039,909 (GRCm39) probably benign Het
Xpr1 A G 1: 155,159,002 (GRCm39) Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,759,916 (GRCm39) probably benign Het
Zfp54 T A 17: 21,654,404 (GRCm39) Y299* probably null Het
Zfp566 T G 7: 29,777,927 (GRCm39) S85R probably benign Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5294:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTAAGTCACAGGCATGAG -3'
(R):5'- TTTGGAAAGCAGAGCCGCAC -3'

Sequencing Primer
(F):5'- CTTAAGTCACAGGCATGAGGGAATG -3'
(R):5'- AGCCGCACCCCTATCCTG -3'
Posted On 2014-06-23