Mutagenetix > Incidental Mutation

Incidental Mutation 'R1855:Rnf123'

206034

Institutional Source

Beutler Lab

Gene Symbol

Rnf123

Ensembl Gene

ENSMUSG00000041528

Gene Name

ring finger protein 123

Synonyms

KPC1

MMRRC Submission

039879-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R1855 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108051534-108083346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108061791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 826 (R826L)

Ref Sequence

ENSEMBL: ENSMUSP00000125745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]

AlphaFold

Q5XPI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000047746
AA Change: R826L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: R826L

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159136

Predicted Effect

probably benign
Transcript: ENSMUST00000159306

SMART Domains

Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

Domain	Start	End	E-Value	Type
coiled coil region	172	192	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160249
AA Change: R820L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: R820L

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160649
AA Change: R820L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: R820L

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160841

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162123

Predicted Effect

probably damaging
Transcript: ENSMUST00000162355
AA Change: R826L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: R826L

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1047	1067	N/A	INTRINSIC
low complexity region	1242	1251	N/A	INTRINSIC
RING	1260	1297	5.27e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173683

Predicted Effect

probably damaging
Transcript: ENSMUST00000178267
AA Change: R820L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: R820L

Domain	Start	End	E-Value	Type
low complexity region	104	115	N/A	INTRINSIC
SPRY	132	253	1.52e-28	SMART
low complexity region	471	488	N/A	INTRINSIC
low complexity region	508	518	N/A	INTRINSIC
coiled coil region	1041	1061	N/A	INTRINSIC
low complexity region	1236	1245	N/A	INTRINSIC
RING	1254	1291	5.27e-4	SMART

Meta Mutation Damage Score

0.4834

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	T	A	1: 11,747,971	L285Q	probably damaging	Het
Acaca	T	C	11: 84,371,554	L1994P	probably damaging	Het
Adamts9	A	G	6: 92,901,369		probably benign	Het
Aff3	T	C	1: 38,210,304	E574G	probably benign	Het
Ankrd1	T	C	19: 36,119,235	K64R	probably damaging	Het
Arhgap23	T	C	11: 97,448,697	I163T	probably damaging	Het
Ascc3	A	T	10: 50,617,922	Q151L	probably benign	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
C1s1	A	C	6: 124,534,356		probably null	Het
Ccdc150	T	C	1: 54,367,910		probably benign	Het
Cdhr3	A	T	12: 33,060,352	I311N	probably damaging	Het
Chad	T	A	11: 94,565,477	L127H	probably damaging	Het
Clasp1	G	A	1: 118,508,894	A303T	probably damaging	Het
Clptm1	A	G	7: 19,638,209	V234A	probably benign	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Col24a1	G	A	3: 145,459,140	G1033D	probably damaging	Het
Csnk1a1	T	A	18: 61,575,427		probably null	Het
Cttnbp2	T	A	6: 18,378,413	I1475L	probably benign	Het
Dnah5	T	C	15: 28,411,669	V3728A	possibly damaging	Het
Dock9	C	A	14: 121,640,159	V391F	probably damaging	Het
Ehmt2	A	T	17: 34,910,776	I949F	probably damaging	Het
Eif4g1	C	A	16: 20,687,161	T1025K	possibly damaging	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Esrrg	A	T	1: 188,211,098	M423L	probably damaging	Het
Etnppl	A	T	3: 130,620,722	I89F	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Fbln7	A	G	2: 128,893,835	T248A	possibly damaging	Het
Galnt9	C	T	5: 110,615,524	T465M	probably damaging	Het
Grcc10	A	G	6: 124,740,578	V57A	probably benign	Het
Herc1	T	A	9: 66,391,426	M614K	possibly damaging	Het
Itch	C	T	2: 155,172,454		probably benign	Het
Kdm6b	C	A	11: 69,407,286	A167S	probably damaging	Het
Kidins220	C	T	12: 25,056,591	R1348C	probably damaging	Het
Kif17	T	C	4: 138,288,271	L577P	probably benign	Het
Krt25	A	T	11: 99,318,315	L258Q	probably damaging	Het
March10	T	C	11: 105,390,392	T356A	probably benign	Het
Mical2	G	A	7: 112,345,282	A940T	probably benign	Het
Mrpl4	A	G	9: 21,003,371	E81G	possibly damaging	Het
Mtcl1	A	G	17: 66,379,514	V447A	probably benign	Het
Mtor	C	A	4: 148,553,089	N2502K	probably benign	Het
Notch4	G	A	17: 34,580,962	D966N	probably benign	Het
Oip5	C	A	2: 119,611,790	K214N	probably benign	Het
Olfr160	A	T	9: 37,711,970	F103Y	possibly damaging	Het
Pak7	A	T	2: 136,087,509	S585T	probably benign	Het
Pard3	T	A	8: 127,447,812		probably null	Het
Pcnx2	A	T	8: 125,807,996		probably benign	Het
Pcsk5	T	C	19: 17,515,192	Y939C	possibly damaging	Het
Pde1a	A	G	2: 79,898,064		probably null	Het
Pde9a	C	T	17: 31,455,120	P60S	probably damaging	Het
Pikfyve	C	A	1: 65,258,798	T1562K	probably benign	Het
Plekhg6	A	T	6: 125,375,839	M115K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Ppp1r3a	A	T	6: 14,754,994	W85R	probably damaging	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc22a2	A	G	17: 12,586,812	D150G	probably damaging	Het
Snap47	C	T	11: 59,428,333		probably benign	Het
Spata22	A	G	11: 73,340,559	D213G	probably benign	Het
St6galnac2	T	A	11: 116,690,315	R60S	probably benign	Het
Stk32c	A	G	7: 139,121,447	F263S	probably damaging	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tex2	T	C	11: 106,546,876	E158G	possibly damaging	Het
Tiam2	C	T	17: 3,415,135	R380C	probably damaging	Het
Trim25	C	T	11: 89,015,581	T410I	probably benign	Het
Usp18	T	A	6: 121,262,117	C212S	probably benign	Het
Vmn1r2	A	G	4: 3,172,588	Y169C	probably damaging	Het
Wdr33	A	T	18: 31,906,856		probably benign	Het
Xpr1	A	G	1: 155,283,256	Y597H	probably benign	Het
Yy1	CGGG	CGGGGGGGGG	12: 108,793,990		probably benign	Het
Zfp54	T	A	17: 21,434,142	Y299*	probably null	Het
Zfp566	T	G	7: 30,078,502	S85R	probably benign	Het

Other mutations in Rnf123

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Rnf123	APN	9	108067395	critical splice donor site	probably null
IGL01358:Rnf123	APN	9	108069182	missense	probably damaging	1.00
IGL01464:Rnf123	APN	9	108052302	missense	probably damaging	1.00
IGL01637:Rnf123	APN	9	108058238	missense	probably damaging	1.00
IGL01669:Rnf123	APN	9	108058356	missense	probably damaging	0.98
IGL01905:Rnf123	APN	9	108071370	splice site	probably benign
IGL02070:Rnf123	APN	9	108068302	nonsense	probably null
IGL02072:Rnf123	APN	9	108068302	nonsense	probably null
IGL02073:Rnf123	APN	9	108068302	nonsense	probably null
IGL02074:Rnf123	APN	9	108066889	missense	probably damaging	1.00
IGL02079:Rnf123	APN	9	108068302	nonsense	probably null
IGL02080:Rnf123	APN	9	108068302	nonsense	probably null
IGL02231:Rnf123	APN	9	108066399	missense	probably benign	0.17
IGL02281:Rnf123	APN	9	108071452	missense	probably benign	0.01
IGL02336:Rnf123	APN	9	108061842	missense	probably damaging	1.00
IGL02543:Rnf123	APN	9	108066348	missense	probably damaging	1.00
IGL02565:Rnf123	APN	9	108052212	critical splice donor site	probably null
IGL02571:Rnf123	APN	9	108068302	nonsense	probably null
IGL02572:Rnf123	APN	9	108068302	nonsense	probably null
IGL02574:Rnf123	APN	9	108068302	nonsense	probably null
IGL02586:Rnf123	APN	9	108068302	nonsense	probably null
IGL02589:Rnf123	APN	9	108068302	nonsense	probably null
IGL02600:Rnf123	APN	9	108068302	nonsense	probably null
IGL02601:Rnf123	APN	9	108068302	nonsense	probably null
IGL02602:Rnf123	APN	9	108068302	nonsense	probably null
IGL02603:Rnf123	APN	9	108068302	nonsense	probably null
IGL02609:Rnf123	APN	9	108068302	nonsense	probably null
IGL02628:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108068302	nonsense	probably null
IGL02629:Rnf123	APN	9	108070789	splice site	probably benign
IGL02630:Rnf123	APN	9	108068302	nonsense	probably null
IGL02631:Rnf123	APN	9	108068302	nonsense	probably null
IGL02632:Rnf123	APN	9	108068302	nonsense	probably null
IGL02650:Rnf123	APN	9	108069748	missense	probably benign	0.29
IGL02690:Rnf123	APN	9	108068302	nonsense	probably null
IGL02691:Rnf123	APN	9	108068302	nonsense	probably null
IGL02692:Rnf123	APN	9	108068302	nonsense	probably null
IGL02693:Rnf123	APN	9	108068302	nonsense	probably null
IGL02713:Rnf123	APN	9	108068302	nonsense	probably null
IGL02736:Rnf123	APN	9	108068302	nonsense	probably null
IGL02929:Rnf123	APN	9	108069076	missense	probably benign
R1175:Rnf123	UTSW	9	108077373	missense	probably benign
R1465:Rnf123	UTSW	9	108071466	splice site	probably benign
R1502:Rnf123	UTSW	9	108068510	splice site	probably null
R1682:Rnf123	UTSW	9	108077398	missense	probably benign	0.16
R1817:Rnf123	UTSW	9	108062926	missense	probably benign	0.41
R2394:Rnf123	UTSW	9	108063536	missense	probably benign	0.00
R2483:Rnf123	UTSW	9	108063521	missense	probably benign	0.16
R3896:Rnf123	UTSW	9	108069103	splice site	probably benign
R3940:Rnf123	UTSW	9	108064035	splice site	probably benign
R4206:Rnf123	UTSW	9	108063963	missense	probably benign	0.01
R4641:Rnf123	UTSW	9	108058587	missense	probably damaging	1.00
R4714:Rnf123	UTSW	9	108052439	splice site	probably null
R4767:Rnf123	UTSW	9	108052089	missense	probably damaging	1.00
R4849:Rnf123	UTSW	9	108056091	missense	probably damaging	1.00
R4899:Rnf123	UTSW	9	108063680	missense	probably damaging	1.00
R5274:Rnf123	UTSW	9	108064003	frame shift	probably null
R5275:Rnf123	UTSW	9	108064003	frame shift	probably null
R5276:Rnf123	UTSW	9	108064003	frame shift	probably null
R5294:Rnf123	UTSW	9	108064003	frame shift	probably null
R5295:Rnf123	UTSW	9	108064003	frame shift	probably null
R5394:Rnf123	UTSW	9	108070731	missense	probably damaging	1.00
R5717:Rnf123	UTSW	9	108067424	missense	probably damaging	1.00
R6186:Rnf123	UTSW	9	108069958	missense	possibly damaging	0.55
R6449:Rnf123	UTSW	9	108056053	missense	probably benign	0.17
R6502:Rnf123	UTSW	9	108068332	missense	possibly damaging	0.46
R6944:Rnf123	UTSW	9	108063623	missense	probably benign	0.02
R7003:Rnf123	UTSW	9	108063683	critical splice acceptor site	probably null
R7088:Rnf123	UTSW	9	108058536	missense	probably null	1.00
R7092:Rnf123	UTSW	9	108068600	missense	probably benign	0.07
R7100:Rnf123	UTSW	9	108056639	missense	probably damaging	1.00
R7257:Rnf123	UTSW	9	108069029	missense	probably damaging	1.00
R7453:Rnf123	UTSW	9	108070408	splice site	probably null
R7468:Rnf123	UTSW	9	108069009	missense	probably benign	0.00
R7517:Rnf123	UTSW	9	108070274	nonsense	probably null
R7577:Rnf123	UTSW	9	108070619	missense	probably damaging	1.00
R8296:Rnf123	UTSW	9	108062890	missense	probably damaging	1.00
R8322:Rnf123	UTSW	9	108068507	missense	probably benign	0.26
R8754:Rnf123	UTSW	9	108071164	missense	probably damaging	1.00
R8783:Rnf123	UTSW	9	108069073	missense	probably benign
R9052:Rnf123	UTSW	9	108059731	missense	probably damaging	1.00
R9156:Rnf123	UTSW	9	108063028	splice site	probably benign
R9170:Rnf123	UTSW	9	108071176	missense	probably damaging	1.00
R9332:Rnf123	UTSW	9	108067505	missense	probably benign	0.00
R9385:Rnf123	UTSW	9	108052268	missense	probably benign	0.02
R9394:Rnf123	UTSW	9	108065706	missense	probably damaging	1.00
R9432:Rnf123	UTSW	9	108059809	missense	probably damaging	0.96
R9717:Rnf123	UTSW	9	108077764	missense	probably benign	0.43
Z1176:Rnf123	UTSW	9	108058395	missense	probably damaging	1.00
Z1176:Rnf123	UTSW	9	108062981	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCTTAAGTCACAGGCATGAG -3'
(R):5'- TTTGGAAAGCAGAGCCGCAC -3'

Sequencing Primer
(F):5'- CTTAAGTCACAGGCATGAGGGAATG -3'
(R):5'- AGCCGCACCCCTATCCTG -3'

Posted On

2014-06-23