Incidental Mutation 'R1855:Dock9'
ID 206053
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 039879-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1855 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 121877571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 391 (V391F)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: V391F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: V391F

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: V393F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: V393F

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: V391F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: V405F

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,818,195 (GRCm39) L285Q probably damaging Het
Acaca T C 11: 84,262,380 (GRCm39) L1994P probably damaging Het
Adamts9 A G 6: 92,878,350 (GRCm39) probably benign Het
Aff3 T C 1: 38,249,385 (GRCm39) E574G probably benign Het
Ankrd1 T C 19: 36,096,635 (GRCm39) K64R probably damaging Het
Arhgap23 T C 11: 97,339,523 (GRCm39) I163T probably damaging Het
Ascc3 A T 10: 50,494,018 (GRCm39) Q151L probably benign Het
Atad2 G A 15: 57,960,685 (GRCm39) P971L possibly damaging Het
C1s1 A C 6: 124,511,315 (GRCm39) probably null Het
Ccdc150 T C 1: 54,407,069 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,351 (GRCm39) I311N probably damaging Het
Chad T A 11: 94,456,303 (GRCm39) L127H probably damaging Het
Clasp1 G A 1: 118,436,624 (GRCm39) A303T probably damaging Het
Clptm1 A G 7: 19,372,134 (GRCm39) V234A probably benign Het
Cnih3 C A 1: 181,282,186 (GRCm39) S140* probably null Het
Col24a1 G A 3: 145,164,895 (GRCm39) G1033D probably damaging Het
Csnk1a1 T A 18: 61,708,498 (GRCm39) probably null Het
Cttnbp2 T A 6: 18,378,412 (GRCm39) I1475L probably benign Het
Dnah5 T C 15: 28,411,815 (GRCm39) V3728A possibly damaging Het
Ehmt2 A T 17: 35,129,752 (GRCm39) I949F probably damaging Het
Eif4g1 C A 16: 20,505,911 (GRCm39) T1025K possibly damaging Het
Enpp2 C T 15: 54,709,219 (GRCm39) E803K probably damaging Het
Esrrg A T 1: 187,943,295 (GRCm39) M423L probably damaging Het
Etnppl A T 3: 130,414,371 (GRCm39) I89F probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fbln7 A G 2: 128,735,755 (GRCm39) T248A possibly damaging Het
Galnt9 C T 5: 110,763,390 (GRCm39) T465M probably damaging Het
Grcc10 A G 6: 124,717,541 (GRCm39) V57A probably benign Het
Herc1 T A 9: 66,298,708 (GRCm39) M614K possibly damaging Het
Itch C T 2: 155,014,374 (GRCm39) probably benign Het
Kdm6b C A 11: 69,298,112 (GRCm39) A167S probably damaging Het
Kidins220 C T 12: 25,106,590 (GRCm39) R1348C probably damaging Het
Kif17 T C 4: 138,015,582 (GRCm39) L577P probably benign Het
Krt25 A T 11: 99,209,141 (GRCm39) L258Q probably damaging Het
Marchf10 T C 11: 105,281,218 (GRCm39) T356A probably benign Het
Mical2 G A 7: 111,944,489 (GRCm39) A940T probably benign Het
Mrpl4 A G 9: 20,914,667 (GRCm39) E81G possibly damaging Het
Mtcl1 A G 17: 66,686,509 (GRCm39) V447A probably benign Het
Mtor C A 4: 148,637,546 (GRCm39) N2502K probably benign Het
Notch4 G A 17: 34,799,936 (GRCm39) D966N probably benign Het
Oip5 C A 2: 119,442,271 (GRCm39) K214N probably benign Het
Or8a1b A T 9: 37,623,266 (GRCm39) F103Y possibly damaging Het
Pabir2 T A X: 52,342,933 (GRCm39) Q201H probably benign Het
Pak5 A T 2: 135,929,429 (GRCm39) S585T probably benign Het
Pard3 T A 8: 128,174,293 (GRCm39) probably null Het
Pcnx2 A T 8: 126,534,735 (GRCm39) probably benign Het
Pcsk5 T C 19: 17,492,556 (GRCm39) Y939C possibly damaging Het
Pde1a A G 2: 79,728,408 (GRCm39) probably null Het
Pde9a C T 17: 31,674,094 (GRCm39) P60S probably damaging Het
Pikfyve C A 1: 65,297,957 (GRCm39) T1562K probably benign Het
Plekhg6 A T 6: 125,352,802 (GRCm39) M115K probably damaging Het
Pogz C T 3: 94,786,160 (GRCm39) T863I probably benign Het
Ppp1r3a A T 6: 14,754,993 (GRCm39) W85R probably damaging Het
Rnf123 C A 9: 107,938,990 (GRCm39) R826L probably damaging Het
Slc1a6 T A 10: 78,648,758 (GRCm39) V493E probably damaging Het
Slc22a2 A G 17: 12,805,699 (GRCm39) D150G probably damaging Het
Snap47 C T 11: 59,319,159 (GRCm39) probably benign Het
Spata22 A G 11: 73,231,385 (GRCm39) D213G probably benign Het
St6galnac2 T A 11: 116,581,141 (GRCm39) R60S probably benign Het
Stk32c A G 7: 138,701,363 (GRCm39) F263S probably damaging Het
Supt6 T C 11: 78,123,366 (GRCm39) I104V possibly damaging Het
Tex2 T C 11: 106,437,702 (GRCm39) E158G possibly damaging Het
Tiam2 C T 17: 3,465,410 (GRCm39) R380C probably damaging Het
Trim25 C T 11: 88,906,407 (GRCm39) T410I probably benign Het
Usp18 T A 6: 121,239,076 (GRCm39) C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 (GRCm39) Y169C probably damaging Het
Wdr33 A T 18: 32,039,909 (GRCm39) probably benign Het
Xpr1 A G 1: 155,159,002 (GRCm39) Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,759,916 (GRCm39) probably benign Het
Zfp54 T A 17: 21,654,404 (GRCm39) Y299* probably null Het
Zfp566 T G 7: 29,777,927 (GRCm39) S85R probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATGAAGGGCATCCTGGAAG -3'
(R):5'- GCATTTGATAGCAAAGCTCATGAG -3'

Sequencing Primer
(F):5'- CATCCTGGAAGGCAGGTG -3'
(R):5'- ATACACAGCTCATCGCTC -3'
Posted On 2014-06-23