Incidental Mutation 'R1855:Dock9'
ID206053
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Namededicator of cytokinesis 9
SynonymsD14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission 039879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1855 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121542046-121797837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121640159 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 391 (V391F)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: V391F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: V391F

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100299
AA Change: V393F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: V393F

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212181
AA Change: V391F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: V405F

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,747,971 L285Q probably damaging Het
Acaca T C 11: 84,371,554 L1994P probably damaging Het
Adamts9 A G 6: 92,901,369 probably benign Het
Aff3 T C 1: 38,210,304 E574G probably benign Het
Ankrd1 T C 19: 36,119,235 K64R probably damaging Het
Arhgap23 T C 11: 97,448,697 I163T probably damaging Het
Ascc3 A T 10: 50,617,922 Q151L probably benign Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
C1s1 A C 6: 124,534,356 probably null Het
Ccdc150 T C 1: 54,367,910 probably benign Het
Cdhr3 A T 12: 33,060,352 I311N probably damaging Het
Chad T A 11: 94,565,477 L127H probably damaging Het
Clasp1 G A 1: 118,508,894 A303T probably damaging Het
Clptm1 A G 7: 19,638,209 V234A probably benign Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Csnk1a1 T A 18: 61,575,427 probably null Het
Cttnbp2 T A 6: 18,378,413 I1475L probably benign Het
Dnah5 T C 15: 28,411,669 V3728A possibly damaging Het
Ehmt2 A T 17: 34,910,776 I949F probably damaging Het
Eif4g1 C A 16: 20,687,161 T1025K possibly damaging Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Esrrg A T 1: 188,211,098 M423L probably damaging Het
Etnppl A T 3: 130,620,722 I89F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Fbln7 A G 2: 128,893,835 T248A possibly damaging Het
Galnt9 C T 5: 110,615,524 T465M probably damaging Het
Grcc10 A G 6: 124,740,578 V57A probably benign Het
Herc1 T A 9: 66,391,426 M614K possibly damaging Het
Itch C T 2: 155,172,454 probably benign Het
Kdm6b C A 11: 69,407,286 A167S probably damaging Het
Kidins220 C T 12: 25,056,591 R1348C probably damaging Het
Kif17 T C 4: 138,288,271 L577P probably benign Het
Krt25 A T 11: 99,318,315 L258Q probably damaging Het
March10 T C 11: 105,390,392 T356A probably benign Het
Mical2 G A 7: 112,345,282 A940T probably benign Het
Mrpl4 A G 9: 21,003,371 E81G possibly damaging Het
Mtcl1 A G 17: 66,379,514 V447A probably benign Het
Mtor C A 4: 148,553,089 N2502K probably benign Het
Notch4 G A 17: 34,580,962 D966N probably benign Het
Oip5 C A 2: 119,611,790 K214N probably benign Het
Olfr160 A T 9: 37,711,970 F103Y possibly damaging Het
Pak7 A T 2: 136,087,509 S585T probably benign Het
Pard3 T A 8: 127,447,812 probably null Het
Pcnx2 A T 8: 125,807,996 probably benign Het
Pcsk5 T C 19: 17,515,192 Y939C possibly damaging Het
Pde1a A G 2: 79,898,064 probably null Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pikfyve C A 1: 65,258,798 T1562K probably benign Het
Plekhg6 A T 6: 125,375,839 M115K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ppp1r3a A T 6: 14,754,994 W85R probably damaging Het
Rnf123 C A 9: 108,061,791 R826L probably damaging Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc22a2 A G 17: 12,586,812 D150G probably damaging Het
Snap47 C T 11: 59,428,333 probably benign Het
Spata22 A G 11: 73,340,559 D213G probably benign Het
St6galnac2 T A 11: 116,690,315 R60S probably benign Het
Stk32c A G 7: 139,121,447 F263S probably damaging Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tex2 T C 11: 106,546,876 E158G possibly damaging Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Trim25 C T 11: 89,015,581 T410I probably benign Het
Usp18 T A 6: 121,262,117 C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 Y169C probably damaging Het
Wdr33 A T 18: 31,906,856 probably benign Het
Xpr1 A G 1: 155,283,256 Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,793,990 probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp566 T G 7: 30,078,502 S85R probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTATGAAGGGCATCCTGGAAG -3'
(R):5'- GCATTTGATAGCAAAGCTCATGAG -3'

Sequencing Primer
(F):5'- CATCCTGGAAGGCAGGTG -3'
(R):5'- ATACACAGCTCATCGCTC -3'
Posted On2014-06-23