Incidental Mutation 'R1855:Slc22a2'
ID206059
Institutional Source Beutler Lab
Gene Symbol Slc22a2
Ensembl Gene ENSMUSG00000040966
Gene Namesolute carrier family 22 (organic cation transporter), member 2
SynonymsOrct2, Oct2
MMRRC Submission 039879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1855 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12584189-12628465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12586812 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 150 (D150G)
Ref Sequence ENSEMBL: ENSMUSP00000041186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046959]
Predicted Effect probably damaging
Transcript: ENSMUST00000046959
AA Change: D150G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041186
Gene: ENSMUSG00000040966
AA Change: D150G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 80 528 7.6e-37 PFAM
Pfam:MFS_1 134 398 3.5e-21 PFAM
Meta Mutation Damage Score 0.4970 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,747,971 L285Q probably damaging Het
Acaca T C 11: 84,371,554 L1994P probably damaging Het
Adamts9 A G 6: 92,901,369 probably benign Het
Aff3 T C 1: 38,210,304 E574G probably benign Het
Ankrd1 T C 19: 36,119,235 K64R probably damaging Het
Arhgap23 T C 11: 97,448,697 I163T probably damaging Het
Ascc3 A T 10: 50,617,922 Q151L probably benign Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
C1s1 A C 6: 124,534,356 probably null Het
Ccdc150 T C 1: 54,367,910 probably benign Het
Cdhr3 A T 12: 33,060,352 I311N probably damaging Het
Chad T A 11: 94,565,477 L127H probably damaging Het
Clasp1 G A 1: 118,508,894 A303T probably damaging Het
Clptm1 A G 7: 19,638,209 V234A probably benign Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Csnk1a1 T A 18: 61,575,427 probably null Het
Cttnbp2 T A 6: 18,378,413 I1475L probably benign Het
Dnah5 T C 15: 28,411,669 V3728A possibly damaging Het
Dock9 C A 14: 121,640,159 V391F probably damaging Het
Ehmt2 A T 17: 34,910,776 I949F probably damaging Het
Eif4g1 C A 16: 20,687,161 T1025K possibly damaging Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Esrrg A T 1: 188,211,098 M423L probably damaging Het
Etnppl A T 3: 130,620,722 I89F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Fbln7 A G 2: 128,893,835 T248A possibly damaging Het
Galnt9 C T 5: 110,615,524 T465M probably damaging Het
Grcc10 A G 6: 124,740,578 V57A probably benign Het
Herc1 T A 9: 66,391,426 M614K possibly damaging Het
Itch C T 2: 155,172,454 probably benign Het
Kdm6b C A 11: 69,407,286 A167S probably damaging Het
Kidins220 C T 12: 25,056,591 R1348C probably damaging Het
Kif17 T C 4: 138,288,271 L577P probably benign Het
Krt25 A T 11: 99,318,315 L258Q probably damaging Het
March10 T C 11: 105,390,392 T356A probably benign Het
Mical2 G A 7: 112,345,282 A940T probably benign Het
Mrpl4 A G 9: 21,003,371 E81G possibly damaging Het
Mtcl1 A G 17: 66,379,514 V447A probably benign Het
Mtor C A 4: 148,553,089 N2502K probably benign Het
Notch4 G A 17: 34,580,962 D966N probably benign Het
Oip5 C A 2: 119,611,790 K214N probably benign Het
Olfr160 A T 9: 37,711,970 F103Y possibly damaging Het
Pak7 A T 2: 136,087,509 S585T probably benign Het
Pard3 T A 8: 127,447,812 probably null Het
Pcnx2 A T 8: 125,807,996 probably benign Het
Pcsk5 T C 19: 17,515,192 Y939C possibly damaging Het
Pde1a A G 2: 79,898,064 probably null Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pikfyve C A 1: 65,258,798 T1562K probably benign Het
Plekhg6 A T 6: 125,375,839 M115K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ppp1r3a A T 6: 14,754,994 W85R probably damaging Het
Rnf123 C A 9: 108,061,791 R826L probably damaging Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Snap47 C T 11: 59,428,333 probably benign Het
Spata22 A G 11: 73,340,559 D213G probably benign Het
St6galnac2 T A 11: 116,690,315 R60S probably benign Het
Stk32c A G 7: 139,121,447 F263S probably damaging Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tex2 T C 11: 106,546,876 E158G possibly damaging Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Trim25 C T 11: 89,015,581 T410I probably benign Het
Usp18 T A 6: 121,262,117 C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 Y169C probably damaging Het
Wdr33 A T 18: 31,906,856 probably benign Het
Xpr1 A G 1: 155,283,256 Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,793,990 probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp566 T G 7: 30,078,502 S85R probably benign Het
Other mutations in Slc22a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc22a2 APN 17 12608418 missense possibly damaging 0.79
IGL00658:Slc22a2 APN 17 12615315 missense probably benign 0.37
IGL01073:Slc22a2 APN 17 12584349 missense probably benign 0.00
IGL01573:Slc22a2 APN 17 12605961 missense probably damaging 0.99
IGL02000:Slc22a2 APN 17 12584383 missense possibly damaging 0.77
IGL02943:Slc22a2 APN 17 12610061 missense probably damaging 1.00
IGL03301:Slc22a2 APN 17 12606039 missense probably damaging 1.00
R0492:Slc22a2 UTSW 17 12615272 missense probably benign 0.00
R0835:Slc22a2 UTSW 17 12612431 missense probably benign 0.01
R1330:Slc22a2 UTSW 17 12586812 missense possibly damaging 0.94
R1432:Slc22a2 UTSW 17 12584308 missense possibly damaging 0.89
R1559:Slc22a2 UTSW 17 12584411 missense probably damaging 1.00
R1884:Slc22a2 UTSW 17 12614826 splice site probably benign
R2042:Slc22a2 UTSW 17 12599125 missense probably benign 0.01
R2197:Slc22a2 UTSW 17 12599062 missense probably damaging 1.00
R2255:Slc22a2 UTSW 17 12599175 missense probably damaging 1.00
R2271:Slc22a2 UTSW 17 12586805 missense probably benign
R4003:Slc22a2 UTSW 17 12612450 missense probably benign 0.01
R4021:Slc22a2 UTSW 17 12584489 missense probably damaging 1.00
R4093:Slc22a2 UTSW 17 12612394 missense probably damaging 1.00
R4404:Slc22a2 UTSW 17 12614764 missense probably damaging 1.00
R4419:Slc22a2 UTSW 17 12612586 nonsense probably null
R4564:Slc22a2 UTSW 17 12610056 missense probably benign 0.08
R4866:Slc22a2 UTSW 17 12584429 missense probably damaging 1.00
R4877:Slc22a2 UTSW 17 12614815 missense possibly damaging 0.53
R5224:Slc22a2 UTSW 17 12586832 missense probably damaging 0.97
R5668:Slc22a2 UTSW 17 12608409 missense probably benign
R6326:Slc22a2 UTSW 17 12612410 nonsense probably null
R7137:Slc22a2 UTSW 17 12584341 missense probably benign
R7211:Slc22a2 UTSW 17 12586883 critical splice donor site probably null
R7378:Slc22a2 UTSW 17 12612391 missense probably damaging 1.00
R7521:Slc22a2 UTSW 17 12586823 missense probably benign 0.14
R7524:Slc22a2 UTSW 17 12606057 missense possibly damaging 0.87
R7735:Slc22a2 UTSW 17 12610030 missense probably damaging 0.99
Z1088:Slc22a2 UTSW 17 12614776 missense probably benign 0.36
Z1176:Slc22a2 UTSW 17 12584625 missense possibly damaging 0.79
Z1177:Slc22a2 UTSW 17 12606010 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCATCACCTGAACCTCTG -3'
(R):5'- AGCAACCACTTTTCAGGCG -3'

Sequencing Primer
(F):5'- ACCTGAACCTCTGGGGCTC -3'
(R):5'- ACCACTTTTCAGGCGGGTGG -3'
Posted On2014-06-23