Incidental Mutation 'R1855:Zfp54'
ID206060
Institutional Source Beutler Lab
Gene Symbol Zfp54
Ensembl Gene ENSMUSG00000023882
Gene Namezinc finger protein 54
SynonymsKRAB10, Zfp-54, Zfp76, clone 18
MMRRC Submission 039879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1855 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21423227-21435640 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21434142 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 299 (Y299*)
Ref Sequence ENSEMBL: ENSMUSP00000132983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007884] [ENSMUST00000165230] [ENSMUST00000167749]
Predicted Effect probably null
Transcript: ENSMUST00000007884
AA Change: Y299*
SMART Domains Protein: ENSMUSP00000007884
Gene: ENSMUSG00000023882
AA Change: Y299*

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165230
AA Change: Y299*
SMART Domains Protein: ENSMUSP00000132983
Gene: ENSMUSG00000023882
AA Change: Y299*

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 2.12e-4 SMART
ZnF_C2H2 299 321 6.67e-2 SMART
ZnF_C2H2 327 349 7.67e-2 SMART
ZnF_C2H2 355 377 2.71e-2 SMART
ZnF_C2H2 383 403 6.24e0 SMART
ZnF_C2H2 411 433 5.99e-4 SMART
ZnF_C2H2 439 461 1.69e-3 SMART
ZnF_C2H2 467 489 2.43e-4 SMART
ZnF_C2H2 495 517 2.3e-5 SMART
ZnF_C2H2 523 545 8.22e-2 SMART
ZnF_C2H2 551 573 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167749
SMART Domains Protein: ENSMUSP00000127089
Gene: ENSMUSG00000023882

DomainStartEndE-ValueType
KRAB 13 73 8.44e-22 SMART
ZnF_C2H2 211 233 1.69e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232563
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,747,971 L285Q probably damaging Het
Acaca T C 11: 84,371,554 L1994P probably damaging Het
Adamts9 A G 6: 92,901,369 probably benign Het
Aff3 T C 1: 38,210,304 E574G probably benign Het
Ankrd1 T C 19: 36,119,235 K64R probably damaging Het
Arhgap23 T C 11: 97,448,697 I163T probably damaging Het
Ascc3 A T 10: 50,617,922 Q151L probably benign Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
C1s1 A C 6: 124,534,356 probably null Het
Ccdc150 T C 1: 54,367,910 probably benign Het
Cdhr3 A T 12: 33,060,352 I311N probably damaging Het
Chad T A 11: 94,565,477 L127H probably damaging Het
Clasp1 G A 1: 118,508,894 A303T probably damaging Het
Clptm1 A G 7: 19,638,209 V234A probably benign Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Csnk1a1 T A 18: 61,575,427 probably null Het
Cttnbp2 T A 6: 18,378,413 I1475L probably benign Het
Dnah5 T C 15: 28,411,669 V3728A possibly damaging Het
Dock9 C A 14: 121,640,159 V391F probably damaging Het
Ehmt2 A T 17: 34,910,776 I949F probably damaging Het
Eif4g1 C A 16: 20,687,161 T1025K possibly damaging Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Esrrg A T 1: 188,211,098 M423L probably damaging Het
Etnppl A T 3: 130,620,722 I89F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Fbln7 A G 2: 128,893,835 T248A possibly damaging Het
Galnt9 C T 5: 110,615,524 T465M probably damaging Het
Grcc10 A G 6: 124,740,578 V57A probably benign Het
Herc1 T A 9: 66,391,426 M614K possibly damaging Het
Itch C T 2: 155,172,454 probably benign Het
Kdm6b C A 11: 69,407,286 A167S probably damaging Het
Kidins220 C T 12: 25,056,591 R1348C probably damaging Het
Kif17 T C 4: 138,288,271 L577P probably benign Het
Krt25 A T 11: 99,318,315 L258Q probably damaging Het
March10 T C 11: 105,390,392 T356A probably benign Het
Mical2 G A 7: 112,345,282 A940T probably benign Het
Mrpl4 A G 9: 21,003,371 E81G possibly damaging Het
Mtcl1 A G 17: 66,379,514 V447A probably benign Het
Mtor C A 4: 148,553,089 N2502K probably benign Het
Notch4 G A 17: 34,580,962 D966N probably benign Het
Oip5 C A 2: 119,611,790 K214N probably benign Het
Olfr160 A T 9: 37,711,970 F103Y possibly damaging Het
Pak7 A T 2: 136,087,509 S585T probably benign Het
Pard3 T A 8: 127,447,812 probably null Het
Pcnx2 A T 8: 125,807,996 probably benign Het
Pcsk5 T C 19: 17,515,192 Y939C possibly damaging Het
Pde1a A G 2: 79,898,064 probably null Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pikfyve C A 1: 65,258,798 T1562K probably benign Het
Plekhg6 A T 6: 125,375,839 M115K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ppp1r3a A T 6: 14,754,994 W85R probably damaging Het
Rnf123 C A 9: 108,061,791 R826L probably damaging Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc22a2 A G 17: 12,586,812 D150G probably damaging Het
Snap47 C T 11: 59,428,333 probably benign Het
Spata22 A G 11: 73,340,559 D213G probably benign Het
St6galnac2 T A 11: 116,690,315 R60S probably benign Het
Stk32c A G 7: 139,121,447 F263S probably damaging Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tex2 T C 11: 106,546,876 E158G possibly damaging Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Trim25 C T 11: 89,015,581 T410I probably benign Het
Usp18 T A 6: 121,262,117 C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 Y169C probably damaging Het
Wdr33 A T 18: 31,906,856 probably benign Het
Xpr1 A G 1: 155,283,256 Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,793,990 probably benign Het
Zfp566 T G 7: 30,078,502 S85R probably benign Het
Other mutations in Zfp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp54 APN 17 21433559 missense possibly damaging 0.62
IGL00425:Zfp54 APN 17 21430297 missense probably damaging 1.00
IGL02830:Zfp54 APN 17 21433456 missense probably damaging 1.00
IGL03037:Zfp54 APN 17 21430215 missense probably damaging 0.99
R1853:Zfp54 UTSW 17 21434142 nonsense probably null
R1915:Zfp54 UTSW 17 21434152 missense probably benign
R3803:Zfp54 UTSW 17 21433552 missense possibly damaging 0.58
R4430:Zfp54 UTSW 17 21434960 missense probably damaging 0.98
R4724:Zfp54 UTSW 17 21433403 missense probably damaging 0.96
R4799:Zfp54 UTSW 17 21434140 missense probably damaging 1.00
R5197:Zfp54 UTSW 17 21434180 missense probably benign 0.12
R5400:Zfp54 UTSW 17 21433700 missense probably benign 0.05
R5422:Zfp54 UTSW 17 21434526 missense probably benign 0.00
R5566:Zfp54 UTSW 17 21433444 missense probably damaging 0.99
R6460:Zfp54 UTSW 17 21433742 missense probably benign
R6528:Zfp54 UTSW 17 21433474 nonsense probably null
R6876:Zfp54 UTSW 17 21433977 missense probably damaging 1.00
R7296:Zfp54 UTSW 17 21433582 missense probably benign 0.11
R7342:Zfp54 UTSW 17 21427752 start gained probably benign
R7660:Zfp54 UTSW 17 21434239 missense probably damaging 1.00
R7701:Zfp54 UTSW 17 21434095 missense probably benign 0.02
R7796:Zfp54 UTSW 17 21434720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCATTTCATCTCTACACACAGTC -3'
(R):5'- GGACTTACCACACTCTTTGCA -3'

Sequencing Primer
(F):5'- CATCAAAGACTTCGTGCTGG -3'
(R):5'- GACTTACCACACTCTTTGCATTTGTG -3'
Posted On2014-06-23