Incidental Mutation 'R1856:Tmem70'
ID 206071
Institutional Source Beutler Lab
Gene Symbol Tmem70
Ensembl Gene ENSMUSG00000025940
Gene Name transmembrane protein 70
Synonyms 1110020A09Rik, 2210416J16Rik
MMRRC Submission 039880-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1856 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 16735431-16748499 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16747497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 205 (T205S)
Ref Sequence ENSEMBL: ENSMUSP00000135483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065373] [ENSMUST00000177501]
AlphaFold Q921N7
Predicted Effect probably damaging
Transcript: ENSMUST00000065373
AA Change: T204S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070497
Gene: ENSMUSG00000025940
AA Change: T204S

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:DUF1301 102 234 1.3e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177501
AA Change: T205S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135483
Gene: ENSMUSG00000025940
AA Change: T205S

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:TMEM70 104 235 2.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177532
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis associated with severe growth delay, impaired biosynthesis and assembly of ATP synthase, decreased ATP production, oxidative stress, delayed heart development, and altered mitochondrial ultrastructure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,504,453 (GRCm39) M233L probably benign Het
Abca14 T G 7: 119,877,404 (GRCm39) F1017L probably damaging Het
Abcb11 A C 2: 69,076,267 (GRCm39) V1147G probably damaging Het
Abcc10 T A 17: 46,617,529 (GRCm39) S1128C probably damaging Het
Adam6a G A 12: 113,508,923 (GRCm39) C432Y probably damaging Het
Adamdec1 C T 14: 68,808,397 (GRCm39) V318M probably damaging Het
Ahnak C A 19: 8,979,412 (GRCm39) S232Y possibly damaging Het
Amt A C 9: 108,174,361 (GRCm39) H42P probably damaging Het
Anapc1 A T 2: 128,501,708 (GRCm39) L778Q probably damaging Het
Ankhd1 G A 18: 36,777,580 (GRCm39) A1588T probably benign Het
Anln A T 9: 22,264,627 (GRCm39) L881Q probably damaging Het
Appl1 A G 14: 26,649,706 (GRCm39) S607P probably damaging Het
Arg2 G T 12: 79,194,436 (GRCm39) V87L probably benign Het
Atp13a2 C T 4: 140,731,323 (GRCm39) P869L probably benign Het
Atxn7l1 T A 12: 33,408,769 (GRCm39) D310E probably damaging Het
Cd6 A T 19: 10,775,966 (GRCm39) D164E probably damaging Het
Cdan1 C A 2: 120,555,417 (GRCm39) V775L probably benign Het
Cep164 A T 9: 45,687,056 (GRCm39) probably null Het
Cep41 A G 6: 30,661,005 (GRCm39) S61P probably damaging Het
Clcn7 C A 17: 25,379,445 (GRCm39) D764E probably damaging Het
Cog2 G A 8: 125,278,142 (GRCm39) G703S possibly damaging Het
Cramp1 T C 17: 25,187,952 (GRCm39) D1214G probably damaging Het
Cst7 G T 2: 150,419,628 (GRCm39) C98F probably damaging Het
Ctc1 T A 11: 68,925,484 (GRCm39) L1007Q probably damaging Het
Cyb5r4 G A 9: 86,904,262 (GRCm39) A11T possibly damaging Het
Dcaf8 A G 1: 172,003,120 (GRCm39) D306G probably damaging Het
Defb38 T A 8: 19,073,592 (GRCm39) K27I probably benign Het
Disp3 T C 4: 148,356,089 (GRCm39) E257G probably damaging Het
Dnajc6 T C 4: 101,456,185 (GRCm39) S58P probably damaging Het
Dock10 A T 1: 80,584,285 (GRCm39) D140E possibly damaging Het
Dop1a T C 9: 86,374,057 (GRCm39) V172A probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Eci3 C T 13: 35,137,011 (GRCm39) A171T possibly damaging Het
Eml2 A G 7: 18,927,986 (GRCm39) D284G probably damaging Het
Eml5 T C 12: 98,776,843 (GRCm39) D1377G probably damaging Het
Fam186a T C 15: 99,838,183 (GRCm39) E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 (GRCm39) L154R probably damaging Het
Gabrb2 A G 11: 42,517,540 (GRCm39) N454S probably benign Het
Gpr183 T A 14: 122,192,153 (GRCm39) I123L probably benign Het
Gucy1b1 A T 3: 81,965,659 (GRCm39) N62K probably benign Het
Hcrtr2 T C 9: 76,167,067 (GRCm39) N90S probably damaging Het
Hectd1 A T 12: 51,791,577 (GRCm39) L2556Q probably damaging Het
Hfm1 T A 5: 106,995,542 (GRCm39) M1290L probably benign Het
Hgsnat A G 8: 26,447,284 (GRCm39) W337R probably benign Het
Hmbox1 T C 14: 65,066,097 (GRCm39) Y291C probably damaging Het
Hmcn1 T C 1: 150,597,415 (GRCm39) N1749S probably benign Het
Igsf10 T C 3: 59,238,693 (GRCm39) D496G possibly damaging Het
Iqch C T 9: 63,441,619 (GRCm39) probably null Het
Irf6 A G 1: 192,849,843 (GRCm39) D255G probably benign Het
Kif9 G A 9: 110,346,787 (GRCm39) G642R probably null Het
Klhl20 A G 1: 160,934,312 (GRCm39) Y236H probably benign Het
Krt39 T A 11: 99,409,914 (GRCm39) K208* probably null Het
Lama3 T A 18: 12,670,838 (GRCm39) L808* probably null Het
Lrp5 C T 19: 3,647,346 (GRCm39) A1299T probably benign Het
Lysmd4 A G 7: 66,875,979 (GRCm39) Q214R probably benign Het
Macf1 T A 4: 123,263,641 (GRCm39) E6960V probably damaging Het
Mcpt2 A G 14: 56,281,156 (GRCm39) E120G probably benign Het
Mpeg1 A G 19: 12,439,720 (GRCm39) T393A probably benign Het
Myh4 G A 11: 67,146,508 (GRCm39) E1494K probably damaging Het
Nbas T G 12: 13,524,230 (GRCm39) S1695R possibly damaging Het
Nlgn1 G T 3: 25,494,201 (GRCm39) Y249* probably null Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nup107 A G 10: 117,586,811 (GRCm39) L910P probably damaging Het
Obscn T A 11: 58,931,122 (GRCm39) D5838V probably damaging Het
Or10g7 T C 9: 39,905,655 (GRCm39) I183T probably benign Het
Or1j18 T C 2: 36,624,357 (GRCm39) I8T probably benign Het
Or4c113 G A 2: 88,885,203 (GRCm39) T189M possibly damaging Het
Or8d2b T C 9: 38,788,892 (GRCm39) I140T possibly damaging Het
Otogl G T 10: 107,690,125 (GRCm39) S915Y possibly damaging Het
P2rx7 T A 5: 122,819,095 (GRCm39) C506S probably damaging Het
P4hb T C 11: 120,454,044 (GRCm39) E350G probably benign Het
Papolg A T 11: 23,817,379 (GRCm39) V606E probably benign Het
Pappa A T 4: 65,258,980 (GRCm39) D1576V probably damaging Het
Pclo G T 5: 14,828,566 (GRCm39) V1402F probably damaging Het
Pdcd11 A G 19: 47,086,626 (GRCm39) T211A probably benign Het
Pdzd2 T C 15: 12,373,941 (GRCm39) R2065G possibly damaging Het
Plcl2 T C 17: 50,914,878 (GRCm39) V629A probably benign Het
Prkcsh G A 9: 21,915,871 (GRCm39) V92I possibly damaging Het
Prpf19 G T 19: 10,879,780 (GRCm39) V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 (GRCm39) I283F probably damaging Het
Rcc2 T A 4: 140,447,915 (GRCm39) D480E probably benign Het
Rnf182 G A 13: 43,821,518 (GRCm39) C23Y probably damaging Het
Rnf186 C T 4: 138,694,673 (GRCm39) T71I probably benign Het
Scyl3 A G 1: 163,761,265 (GRCm39) probably null Het
Slc12a6 G T 2: 112,166,272 (GRCm39) probably null Het
Slc1a2 C A 2: 102,607,912 (GRCm39) S520Y probably damaging Het
Slc35e2 T A 4: 155,696,186 (GRCm39) L191Q probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx33 T C 9: 56,833,295 (GRCm39) H258R possibly damaging Het
Tecpr2 A T 12: 110,899,498 (GRCm39) H622L probably benign Het
Thbs3 A T 3: 89,133,713 (GRCm39) E888D probably damaging Het
Tlk2 T C 11: 105,112,124 (GRCm39) L159P probably benign Het
Trappc10 T A 10: 78,032,285 (GRCm39) H1001L probably benign Het
Trim12a T C 7: 103,950,064 (GRCm39) T292A probably benign Het
Trip11 G A 12: 101,849,592 (GRCm39) R92* probably null Het
Trpa1 G A 1: 14,969,612 (GRCm39) Q386* probably null Het
Trpc4 T A 3: 54,187,410 (GRCm39) V454D probably damaging Het
Ttc36 A T 9: 44,714,051 (GRCm39) D22E probably benign Het
Ttk A T 9: 83,751,316 (GRCm39) I798F probably damaging Het
Ttn T C 2: 76,573,977 (GRCm39) I17312V probably damaging Het
Txndc15 A T 13: 55,865,875 (GRCm39) E113V possibly damaging Het
Ube2d4 T A 15: 58,718,448 (GRCm39) noncoding transcript Het
Urb1 T A 16: 90,558,583 (GRCm39) T1723S probably benign Het
Vmn1r65 A T 7: 6,011,265 (GRCm39) V323D possibly damaging Het
Vmn2r54 A G 7: 12,366,238 (GRCm39) M232T probably benign Het
Wdr59 A G 8: 112,202,813 (GRCm39) S577P probably damaging Het
Wfikkn2 C T 11: 94,128,949 (GRCm39) W397* probably null Het
Ypel1 T A 16: 16,899,511 (GRCm39) probably null Het
Ythdf1 T A 2: 180,552,763 (GRCm39) D484V probably damaging Het
Zdhhc17 A G 10: 110,783,154 (GRCm39) probably null Het
Zfp472 A T 17: 33,184,887 (GRCm39) H2L possibly damaging Het
Zfp953 A T 13: 67,493,422 (GRCm39) M74K probably benign Het
Zmat4 C T 8: 24,419,151 (GRCm39) T61M probably benign Het
Other mutations in Tmem70
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2496:Tmem70 UTSW 1 16,735,575 (GRCm39) missense probably benign 0.02
R3040:Tmem70 UTSW 1 16,737,989 (GRCm39) missense possibly damaging 0.47
R5853:Tmem70 UTSW 1 16,735,556 (GRCm39) missense possibly damaging 0.96
R5939:Tmem70 UTSW 1 16,747,615 (GRCm39) missense probably benign 0.00
R6707:Tmem70 UTSW 1 16,747,531 (GRCm39) missense probably damaging 1.00
R6942:Tmem70 UTSW 1 16,747,380 (GRCm39) missense probably damaging 1.00
R7260:Tmem70 UTSW 1 16,735,590 (GRCm39) missense possibly damaging 0.58
R7899:Tmem70 UTSW 1 16,747,268 (GRCm39) missense probably benign 0.00
R9304:Tmem70 UTSW 1 16,737,989 (GRCm39) missense possibly damaging 0.47
R9667:Tmem70 UTSW 1 16,735,659 (GRCm39) missense probably benign 0.00
R9668:Tmem70 UTSW 1 16,735,659 (GRCm39) missense probably benign 0.00
R9695:Tmem70 UTSW 1 16,735,659 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGTCTTATTTTACGGAGTCATGGG -3'
(R):5'- CCCTGAAAATACATGACATTTAAGC -3'

Sequencing Primer
(F):5'- TGGGAAGCTTCACAGTGATCACTC -3'
(R):5'- TTAAGCACAAATGAAGAACAGGTTC -3'
Posted On 2014-06-23