Incidental Mutation 'R1856:Dock10'
ID 206072
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Name dedicator of cytokinesis 10
Synonyms Zizimin3, A630054M16Rik, Jr5, ZIZ3, Jr4, 9330153B10Rik
MMRRC Submission 039880-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R1856 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 80478790-80736244 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80584285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 140 (D140E)
Ref Sequence ENSEMBL: ENSMUSP00000140513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000186087] [ENSMUST00000187774] [ENSMUST00000190983] [ENSMUST00000191449]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000077946
AA Change: D158E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: D158E

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186087
AA Change: D171E

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140102
Gene: ENSMUSG00000038608
AA Change: D171E

DomainStartEndE-ValueType
Pfam:DUF3398 71 166 1.5e-29 PFAM
PH 195 305 3.9e-19 SMART
Blast:PH 363 475 3e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000187774
AA Change: D146E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: D146E

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190983
AA Change: D145E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: D145E

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191449
AA Change: D140E

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140513
Gene: ENSMUSG00000038608
AA Change: D140E

DomainStartEndE-ValueType
Pfam:DUF3398 40 135 1.1e-32 PFAM
PH 164 274 8.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191505
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,504,453 (GRCm39) M233L probably benign Het
Abca14 T G 7: 119,877,404 (GRCm39) F1017L probably damaging Het
Abcb11 A C 2: 69,076,267 (GRCm39) V1147G probably damaging Het
Abcc10 T A 17: 46,617,529 (GRCm39) S1128C probably damaging Het
Adam6a G A 12: 113,508,923 (GRCm39) C432Y probably damaging Het
Adamdec1 C T 14: 68,808,397 (GRCm39) V318M probably damaging Het
Ahnak C A 19: 8,979,412 (GRCm39) S232Y possibly damaging Het
Amt A C 9: 108,174,361 (GRCm39) H42P probably damaging Het
Anapc1 A T 2: 128,501,708 (GRCm39) L778Q probably damaging Het
Ankhd1 G A 18: 36,777,580 (GRCm39) A1588T probably benign Het
Anln A T 9: 22,264,627 (GRCm39) L881Q probably damaging Het
Appl1 A G 14: 26,649,706 (GRCm39) S607P probably damaging Het
Arg2 G T 12: 79,194,436 (GRCm39) V87L probably benign Het
Atp13a2 C T 4: 140,731,323 (GRCm39) P869L probably benign Het
Atxn7l1 T A 12: 33,408,769 (GRCm39) D310E probably damaging Het
Cd6 A T 19: 10,775,966 (GRCm39) D164E probably damaging Het
Cdan1 C A 2: 120,555,417 (GRCm39) V775L probably benign Het
Cep164 A T 9: 45,687,056 (GRCm39) probably null Het
Cep41 A G 6: 30,661,005 (GRCm39) S61P probably damaging Het
Clcn7 C A 17: 25,379,445 (GRCm39) D764E probably damaging Het
Cog2 G A 8: 125,278,142 (GRCm39) G703S possibly damaging Het
Cramp1 T C 17: 25,187,952 (GRCm39) D1214G probably damaging Het
Cst7 G T 2: 150,419,628 (GRCm39) C98F probably damaging Het
Ctc1 T A 11: 68,925,484 (GRCm39) L1007Q probably damaging Het
Cyb5r4 G A 9: 86,904,262 (GRCm39) A11T possibly damaging Het
Dcaf8 A G 1: 172,003,120 (GRCm39) D306G probably damaging Het
Defb38 T A 8: 19,073,592 (GRCm39) K27I probably benign Het
Disp3 T C 4: 148,356,089 (GRCm39) E257G probably damaging Het
Dnajc6 T C 4: 101,456,185 (GRCm39) S58P probably damaging Het
Dop1a T C 9: 86,374,057 (GRCm39) V172A probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Eci3 C T 13: 35,137,011 (GRCm39) A171T possibly damaging Het
Eml2 A G 7: 18,927,986 (GRCm39) D284G probably damaging Het
Eml5 T C 12: 98,776,843 (GRCm39) D1377G probably damaging Het
Fam186a T C 15: 99,838,183 (GRCm39) E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 (GRCm39) L154R probably damaging Het
Gabrb2 A G 11: 42,517,540 (GRCm39) N454S probably benign Het
Gpr183 T A 14: 122,192,153 (GRCm39) I123L probably benign Het
Gucy1b1 A T 3: 81,965,659 (GRCm39) N62K probably benign Het
Hcrtr2 T C 9: 76,167,067 (GRCm39) N90S probably damaging Het
Hectd1 A T 12: 51,791,577 (GRCm39) L2556Q probably damaging Het
Hfm1 T A 5: 106,995,542 (GRCm39) M1290L probably benign Het
Hgsnat A G 8: 26,447,284 (GRCm39) W337R probably benign Het
Hmbox1 T C 14: 65,066,097 (GRCm39) Y291C probably damaging Het
Hmcn1 T C 1: 150,597,415 (GRCm39) N1749S probably benign Het
Igsf10 T C 3: 59,238,693 (GRCm39) D496G possibly damaging Het
Iqch C T 9: 63,441,619 (GRCm39) probably null Het
Irf6 A G 1: 192,849,843 (GRCm39) D255G probably benign Het
Kif9 G A 9: 110,346,787 (GRCm39) G642R probably null Het
Klhl20 A G 1: 160,934,312 (GRCm39) Y236H probably benign Het
Krt39 T A 11: 99,409,914 (GRCm39) K208* probably null Het
Lama3 T A 18: 12,670,838 (GRCm39) L808* probably null Het
Lrp5 C T 19: 3,647,346 (GRCm39) A1299T probably benign Het
Lysmd4 A G 7: 66,875,979 (GRCm39) Q214R probably benign Het
Macf1 T A 4: 123,263,641 (GRCm39) E6960V probably damaging Het
Mcpt2 A G 14: 56,281,156 (GRCm39) E120G probably benign Het
Mpeg1 A G 19: 12,439,720 (GRCm39) T393A probably benign Het
Myh4 G A 11: 67,146,508 (GRCm39) E1494K probably damaging Het
Nbas T G 12: 13,524,230 (GRCm39) S1695R possibly damaging Het
Nlgn1 G T 3: 25,494,201 (GRCm39) Y249* probably null Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nup107 A G 10: 117,586,811 (GRCm39) L910P probably damaging Het
Obscn T A 11: 58,931,122 (GRCm39) D5838V probably damaging Het
Or10g7 T C 9: 39,905,655 (GRCm39) I183T probably benign Het
Or1j18 T C 2: 36,624,357 (GRCm39) I8T probably benign Het
Or4c113 G A 2: 88,885,203 (GRCm39) T189M possibly damaging Het
Or8d2b T C 9: 38,788,892 (GRCm39) I140T possibly damaging Het
Otogl G T 10: 107,690,125 (GRCm39) S915Y possibly damaging Het
P2rx7 T A 5: 122,819,095 (GRCm39) C506S probably damaging Het
P4hb T C 11: 120,454,044 (GRCm39) E350G probably benign Het
Papolg A T 11: 23,817,379 (GRCm39) V606E probably benign Het
Pappa A T 4: 65,258,980 (GRCm39) D1576V probably damaging Het
Pclo G T 5: 14,828,566 (GRCm39) V1402F probably damaging Het
Pdcd11 A G 19: 47,086,626 (GRCm39) T211A probably benign Het
Pdzd2 T C 15: 12,373,941 (GRCm39) R2065G possibly damaging Het
Plcl2 T C 17: 50,914,878 (GRCm39) V629A probably benign Het
Prkcsh G A 9: 21,915,871 (GRCm39) V92I possibly damaging Het
Prpf19 G T 19: 10,879,780 (GRCm39) V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 (GRCm39) I283F probably damaging Het
Rcc2 T A 4: 140,447,915 (GRCm39) D480E probably benign Het
Rnf182 G A 13: 43,821,518 (GRCm39) C23Y probably damaging Het
Rnf186 C T 4: 138,694,673 (GRCm39) T71I probably benign Het
Scyl3 A G 1: 163,761,265 (GRCm39) probably null Het
Slc12a6 G T 2: 112,166,272 (GRCm39) probably null Het
Slc1a2 C A 2: 102,607,912 (GRCm39) S520Y probably damaging Het
Slc35e2 T A 4: 155,696,186 (GRCm39) L191Q probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx33 T C 9: 56,833,295 (GRCm39) H258R possibly damaging Het
Tecpr2 A T 12: 110,899,498 (GRCm39) H622L probably benign Het
Thbs3 A T 3: 89,133,713 (GRCm39) E888D probably damaging Het
Tlk2 T C 11: 105,112,124 (GRCm39) L159P probably benign Het
Tmem70 A T 1: 16,747,497 (GRCm39) T205S probably damaging Het
Trappc10 T A 10: 78,032,285 (GRCm39) H1001L probably benign Het
Trim12a T C 7: 103,950,064 (GRCm39) T292A probably benign Het
Trip11 G A 12: 101,849,592 (GRCm39) R92* probably null Het
Trpa1 G A 1: 14,969,612 (GRCm39) Q386* probably null Het
Trpc4 T A 3: 54,187,410 (GRCm39) V454D probably damaging Het
Ttc36 A T 9: 44,714,051 (GRCm39) D22E probably benign Het
Ttk A T 9: 83,751,316 (GRCm39) I798F probably damaging Het
Ttn T C 2: 76,573,977 (GRCm39) I17312V probably damaging Het
Txndc15 A T 13: 55,865,875 (GRCm39) E113V possibly damaging Het
Ube2d4 T A 15: 58,718,448 (GRCm39) noncoding transcript Het
Urb1 T A 16: 90,558,583 (GRCm39) T1723S probably benign Het
Vmn1r65 A T 7: 6,011,265 (GRCm39) V323D possibly damaging Het
Vmn2r54 A G 7: 12,366,238 (GRCm39) M232T probably benign Het
Wdr59 A G 8: 112,202,813 (GRCm39) S577P probably damaging Het
Wfikkn2 C T 11: 94,128,949 (GRCm39) W397* probably null Het
Ypel1 T A 16: 16,899,511 (GRCm39) probably null Het
Ythdf1 T A 2: 180,552,763 (GRCm39) D484V probably damaging Het
Zdhhc17 A G 10: 110,783,154 (GRCm39) probably null Het
Zfp472 A T 17: 33,184,887 (GRCm39) H2L possibly damaging Het
Zfp953 A T 13: 67,493,422 (GRCm39) M74K probably benign Het
Zmat4 C T 8: 24,419,151 (GRCm39) T61M probably benign Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80,562,729 (GRCm39) missense probably damaging 1.00
IGL00783:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00784:Dock10 APN 1 80,550,166 (GRCm39) splice site probably benign
IGL00858:Dock10 APN 1 80,545,720 (GRCm39) missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80,508,962 (GRCm39) missense probably damaging 1.00
IGL01351:Dock10 APN 1 80,570,876 (GRCm39) missense probably damaging 1.00
IGL01356:Dock10 APN 1 80,501,459 (GRCm39) missense probably damaging 1.00
IGL01584:Dock10 APN 1 80,511,567 (GRCm39) missense probably damaging 0.99
IGL01619:Dock10 APN 1 80,612,015 (GRCm39) splice site probably benign
IGL01678:Dock10 APN 1 80,521,069 (GRCm39) missense probably damaging 1.00
IGL01759:Dock10 APN 1 80,503,990 (GRCm39) missense probably damaging 1.00
IGL02238:Dock10 APN 1 80,511,510 (GRCm39) missense probably damaging 0.99
IGL02352:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02359:Dock10 APN 1 80,483,378 (GRCm39) missense probably damaging 1.00
IGL02377:Dock10 APN 1 80,562,711 (GRCm39) critical splice donor site probably null
IGL02433:Dock10 APN 1 80,507,905 (GRCm39) missense probably damaging 1.00
IGL02471:Dock10 APN 1 80,493,339 (GRCm39) missense probably damaging 0.99
IGL02645:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02646:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02648:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02649:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02650:Dock10 APN 1 80,551,840 (GRCm39) missense probably damaging 1.00
IGL02652:Dock10 APN 1 80,570,561 (GRCm39) splice site probably null
IGL02718:Dock10 APN 1 80,501,535 (GRCm39) missense probably benign 0.00
IGL02998:Dock10 APN 1 80,551,259 (GRCm39) missense probably damaging 1.00
IGL03057:Dock10 APN 1 80,545,088 (GRCm39) missense probably damaging 1.00
IGL03066:Dock10 APN 1 80,562,758 (GRCm39) missense probably benign 0.00
IGL03106:Dock10 APN 1 80,546,551 (GRCm39) missense probably damaging 0.98
IGL03148:Dock10 APN 1 80,518,075 (GRCm39) missense probably benign 0.01
IGL03271:Dock10 APN 1 80,483,126 (GRCm39) missense probably damaging 1.00
IGL03352:Dock10 APN 1 80,584,013 (GRCm39) splice site probably benign
LCD18:Dock10 UTSW 1 80,716,623 (GRCm38) intron probably benign
PIT4366001:Dock10 UTSW 1 80,573,438 (GRCm39) missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80,483,163 (GRCm39) missense probably damaging 1.00
R0019:Dock10 UTSW 1 80,583,642 (GRCm39) missense probably damaging 1.00
R0081:Dock10 UTSW 1 80,584,295 (GRCm39) missense probably damaging 0.99
R0095:Dock10 UTSW 1 80,501,788 (GRCm39) missense probably benign 0.00
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0241:Dock10 UTSW 1 80,556,340 (GRCm39) missense probably benign
R0255:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R0267:Dock10 UTSW 1 80,490,171 (GRCm39) missense probably damaging 1.00
R0299:Dock10 UTSW 1 80,514,646 (GRCm39) missense probably damaging 0.99
R0365:Dock10 UTSW 1 80,573,400 (GRCm39) missense probably damaging 1.00
R0387:Dock10 UTSW 1 80,517,993 (GRCm39) missense probably damaging 1.00
R0403:Dock10 UTSW 1 80,501,787 (GRCm39) missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80,518,193 (GRCm39) missense probably benign 0.03
R0414:Dock10 UTSW 1 80,513,650 (GRCm39) missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80,518,936 (GRCm39) splice site probably benign
R0698:Dock10 UTSW 1 80,507,895 (GRCm39) missense probably damaging 1.00
R0711:Dock10 UTSW 1 80,501,692 (GRCm39) missense probably damaging 1.00
R0925:Dock10 UTSW 1 80,514,657 (GRCm39) missense probably benign 0.20
R1162:Dock10 UTSW 1 80,546,559 (GRCm39) missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80,518,060 (GRCm39) missense probably damaging 1.00
R1440:Dock10 UTSW 1 80,526,853 (GRCm39) missense probably benign 0.03
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1469:Dock10 UTSW 1 80,490,275 (GRCm39) missense probably benign 0.05
R1525:Dock10 UTSW 1 80,583,881 (GRCm39) critical splice donor site probably null
R1544:Dock10 UTSW 1 80,570,352 (GRCm39) missense probably benign 0.00
R1601:Dock10 UTSW 1 80,527,519 (GRCm39) missense probably benign 0.00
R1757:Dock10 UTSW 1 80,511,586 (GRCm39) missense probably damaging 1.00
R1765:Dock10 UTSW 1 80,583,540 (GRCm39) missense probably damaging 1.00
R1783:Dock10 UTSW 1 80,551,897 (GRCm39) missense probably benign 0.17
R1823:Dock10 UTSW 1 80,520,814 (GRCm39) splice site probably null
R1827:Dock10 UTSW 1 80,508,009 (GRCm39) missense probably benign 0.07
R1844:Dock10 UTSW 1 80,520,918 (GRCm39) missense probably damaging 0.99
R1974:Dock10 UTSW 1 80,488,143 (GRCm39) missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80,527,506 (GRCm39) missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80,483,360 (GRCm39) missense probably damaging 0.99
R2112:Dock10 UTSW 1 80,483,359 (GRCm39) missense probably damaging 1.00
R2113:Dock10 UTSW 1 80,584,280 (GRCm39) missense probably damaging 1.00
R2439:Dock10 UTSW 1 80,510,149 (GRCm39) missense probably damaging 1.00
R2566:Dock10 UTSW 1 80,517,970 (GRCm39) missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80,510,074 (GRCm39) missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80,514,643 (GRCm39) missense probably damaging 0.99
R3768:Dock10 UTSW 1 80,510,085 (GRCm39) missense probably damaging 1.00
R4009:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R4016:Dock10 UTSW 1 80,584,286 (GRCm39) missense probably damaging 1.00
R4179:Dock10 UTSW 1 80,488,134 (GRCm39) missense probably benign 0.00
R4243:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4244:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4245:Dock10 UTSW 1 80,544,472 (GRCm39) missense probably benign 0.00
R4674:Dock10 UTSW 1 80,584,337 (GRCm39) missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80,493,330 (GRCm39) missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80,518,998 (GRCm39) missense probably damaging 1.00
R4851:Dock10 UTSW 1 80,526,874 (GRCm39) missense probably benign 0.33
R4911:Dock10 UTSW 1 80,583,953 (GRCm39) missense probably damaging 1.00
R4976:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5086:Dock10 UTSW 1 80,529,189 (GRCm39) missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80,545,711 (GRCm39) critical splice donor site probably null
R5301:Dock10 UTSW 1 80,625,973 (GRCm39) missense probably benign 0.41
R5404:Dock10 UTSW 1 80,481,630 (GRCm39) intron probably benign
R5457:Dock10 UTSW 1 80,501,781 (GRCm39) missense probably damaging 1.00
R5790:Dock10 UTSW 1 80,482,887 (GRCm39) missense probably benign 0.00
R5845:Dock10 UTSW 1 80,483,459 (GRCm39) intron probably benign
R5871:Dock10 UTSW 1 80,519,057 (GRCm39) critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80,551,855 (GRCm39) missense probably damaging 1.00
R5881:Dock10 UTSW 1 80,538,640 (GRCm39) missense probably benign 0.19
R5895:Dock10 UTSW 1 80,514,676 (GRCm39) missense probably benign
R5935:Dock10 UTSW 1 80,483,304 (GRCm39) intron probably benign
R5965:Dock10 UTSW 1 80,546,461 (GRCm39) splice site probably null
R5966:Dock10 UTSW 1 80,546,225 (GRCm39) missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80,583,890 (GRCm39) missense probably damaging 0.98
R6029:Dock10 UTSW 1 80,514,663 (GRCm39) missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80,510,148 (GRCm39) missense probably damaging 1.00
R6145:Dock10 UTSW 1 80,553,621 (GRCm39) nonsense probably null
R6257:Dock10 UTSW 1 80,481,413 (GRCm39) intron probably benign
R6274:Dock10 UTSW 1 80,516,540 (GRCm39) missense probably damaging 1.00
R6324:Dock10 UTSW 1 80,482,893 (GRCm39) missense probably benign 0.03
R6346:Dock10 UTSW 1 80,553,573 (GRCm39) splice site probably null
R6476:Dock10 UTSW 1 80,518,959 (GRCm39) nonsense probably null
R6516:Dock10 UTSW 1 80,518,178 (GRCm39) missense probably damaging 1.00
R6526:Dock10 UTSW 1 80,564,068 (GRCm39) missense probably damaging 0.97
R6534:Dock10 UTSW 1 80,481,388 (GRCm39) missense probably benign 0.01
R6620:Dock10 UTSW 1 80,570,355 (GRCm39) missense probably benign 0.01
R6640:Dock10 UTSW 1 80,511,555 (GRCm39) nonsense probably null
R6669:Dock10 UTSW 1 80,570,572 (GRCm39) missense probably damaging 1.00
R6672:Dock10 UTSW 1 80,490,248 (GRCm39) missense probably benign 0.00
R6679:Dock10 UTSW 1 80,544,514 (GRCm39) missense probably benign 0.11
R6682:Dock10 UTSW 1 80,490,338 (GRCm39) missense probably damaging 1.00
R6712:Dock10 UTSW 1 80,514,583 (GRCm39) missense probably benign 0.00
R6726:Dock10 UTSW 1 80,490,147 (GRCm39) missense probably damaging 1.00
R6788:Dock10 UTSW 1 80,508,962 (GRCm39) missense probably damaging 1.00
R6805:Dock10 UTSW 1 80,564,407 (GRCm39) missense probably benign
R6815:Dock10 UTSW 1 80,516,576 (GRCm39) missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80,593,082 (GRCm39) missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80,508,976 (GRCm39) missense probably damaging 1.00
R6964:Dock10 UTSW 1 80,481,365 (GRCm39) intron probably benign
R7026:Dock10 UTSW 1 80,479,504 (GRCm39) missense probably benign 0.40
R7084:Dock10 UTSW 1 80,481,573 (GRCm39) missense
R7087:Dock10 UTSW 1 80,570,543 (GRCm39) missense probably benign
R7158:Dock10 UTSW 1 80,564,589 (GRCm39) critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80,518,048 (GRCm39) missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80,546,246 (GRCm39) missense probably benign 0.01
R7255:Dock10 UTSW 1 80,520,816 (GRCm39) critical splice donor site probably null
R7320:Dock10 UTSW 1 80,527,421 (GRCm39) critical splice donor site probably null
R7359:Dock10 UTSW 1 80,687,065 (GRCm39) missense probably benign 0.01
R7423:Dock10 UTSW 1 80,501,497 (GRCm39) missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80,518,032 (GRCm39) missense probably damaging 0.99
R7483:Dock10 UTSW 1 80,493,283 (GRCm39) missense probably benign 0.01
R7487:Dock10 UTSW 1 80,562,765 (GRCm39) missense probably benign 0.00
R7789:Dock10 UTSW 1 80,536,930 (GRCm39) missense possibly damaging 0.82
R7943:Dock10 UTSW 1 80,626,006 (GRCm39) missense probably damaging 0.98
R7962:Dock10 UTSW 1 80,564,085 (GRCm39) missense possibly damaging 0.88
R8079:Dock10 UTSW 1 80,556,421 (GRCm39) missense probably benign 0.00
R8086:Dock10 UTSW 1 80,481,707 (GRCm39) missense probably benign 0.17
R8184:Dock10 UTSW 1 80,530,469 (GRCm39) missense probably damaging 1.00
R8220:Dock10 UTSW 1 80,506,366 (GRCm39) missense probably null 1.00
R8225:Dock10 UTSW 1 80,481,447 (GRCm39) nonsense probably null
R8267:Dock10 UTSW 1 80,518,045 (GRCm39) missense probably benign 0.00
R8276:Dock10 UTSW 1 80,505,998 (GRCm39) missense probably benign
R8294:Dock10 UTSW 1 80,488,079 (GRCm39) missense possibly damaging 0.88
R8298:Dock10 UTSW 1 80,514,654 (GRCm39) missense probably benign 0.00
R8326:Dock10 UTSW 1 80,583,892 (GRCm39) missense possibly damaging 0.77
R8724:Dock10 UTSW 1 80,570,344 (GRCm39) missense probably benign 0.00
R8828:Dock10 UTSW 1 80,521,134 (GRCm39) missense probably damaging 1.00
R8846:Dock10 UTSW 1 80,545,786 (GRCm39) missense possibly damaging 0.93
R8919:Dock10 UTSW 1 80,483,147 (GRCm39) missense probably benign 0.00
R8950:Dock10 UTSW 1 80,519,016 (GRCm39) missense probably benign
R8993:Dock10 UTSW 1 80,551,888 (GRCm39) missense probably benign 0.21
R9028:Dock10 UTSW 1 80,584,012 (GRCm39) splice site probably benign
R9115:Dock10 UTSW 1 80,490,156 (GRCm39) missense probably damaging 1.00
R9327:Dock10 UTSW 1 80,510,184 (GRCm39) missense probably damaging 1.00
R9342:Dock10 UTSW 1 80,570,360 (GRCm39) missense probably benign
R9421:Dock10 UTSW 1 80,501,509 (GRCm39) missense probably damaging 1.00
R9431:Dock10 UTSW 1 80,583,593 (GRCm39) missense probably damaging 1.00
R9486:Dock10 UTSW 1 80,479,452 (GRCm39) missense unknown
R9521:Dock10 UTSW 1 80,501,763 (GRCm39) missense probably damaging 1.00
R9598:Dock10 UTSW 1 80,625,939 (GRCm39) missense probably benign 0.15
R9629:Dock10 UTSW 1 80,481,389 (GRCm39) missense
R9703:Dock10 UTSW 1 80,517,540 (GRCm39) missense probably damaging 0.98
RF021:Dock10 UTSW 1 80,542,290 (GRCm39) critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80,514,637 (GRCm39) missense probably damaging 0.98
X0065:Dock10 UTSW 1 80,518,977 (GRCm39) missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80,510,064 (GRCm39) missense probably damaging 1.00
Z1176:Dock10 UTSW 1 80,538,671 (GRCm39) missense probably benign
Z1177:Dock10 UTSW 1 80,536,917 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGCCCAGATCTTAGACACTGC -3'
(R):5'- GTTGCAAAGCTTACAAAACCTG -3'

Sequencing Primer
(F):5'- GACTCATCCGTAATAATCGTGTTC -3'
(R):5'- CCTGAAACAATGTTAATGGAATCGG -3'
Posted On 2014-06-23