Mutagenetix > Incidental Mutation

Incidental Mutation 'R1856:Slc12a6'

206085

Institutional Source

Beutler Lab

Gene Symbol

Slc12a6

Ensembl Gene

ENSMUSG00000027130

Gene Name

solute carrier family 12, member 6

Synonyms

gaxp, KCC3

MMRRC Submission

039880-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.265) question?

Stock #

R1856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112265825-112363163 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to T at 112335927 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]

AlphaFold

Q924N4

Predicted Effect

probably null
Transcript: ENSMUST00000028549

SMART Domains

Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	8e-3	SMART
Pfam:AA_permease	190	384	4.1e-25	PFAM
Pfam:AA_permease	453	761	2.3e-43	PFAM
Pfam:SLC12	773	897	7.1e-20	PFAM
Pfam:SLC12	892	1150	3.9e-32	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000053666

SMART Domains

Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130

Domain	Start	End	E-Value	Type
Pfam:AA_permease	139	333	2.3e-25	PFAM
Pfam:AA_permease_2	385	668	1.5e-19	PFAM
Pfam:AA_permease	391	710	4.5e-41	PFAM
low complexity region	828	842	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	967	996	2.2e-23	PFAM
low complexity region	1079	1091	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110987

SMART Domains

Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	4e-3	SMART
Pfam:AA_permease	175	369	3.9e-25	PFAM
Pfam:AA_permease_2	421	704	3.2e-19	PFAM
Pfam:AA_permease	426	746	5.8e-41	PFAM
low complexity region	864	878	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110991

SMART Domains

Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	7e-3	SMART
Pfam:AA_permease	190	384	4.2e-25	PFAM
Pfam:AA_permease_2	436	719	2.9e-19	PFAM
Pfam:AA_permease	442	761	8.2e-41	PFAM
low complexity region	879	893	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	1018	1047	2.7e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141047

SMART Domains

Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	8e-3	SMART
Pfam:AA_permease	175	369	6.6e-25	PFAM
Pfam:AA_permease	438	746	3.6e-43	PFAM
Pfam:SLC12	758	884	6.8e-20	PFAM
Pfam:SLC12	877	1033	5.9e-20	PFAM

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	G	7: 120,278,181	F1017L	probably damaging	Het
Abcb11	A	C	2: 69,245,923	V1147G	probably damaging	Het
Abcc10	T	A	17: 46,306,603	S1128C	probably damaging	Het
Adam6a	G	A	12: 113,545,303	C432Y	probably damaging	Het
Adamdec1	C	T	14: 68,570,948	V318M	probably damaging	Het
Ahnak	C	A	19: 9,002,048	S232Y	possibly damaging	Het
Amt	A	C	9: 108,297,162	H42P	probably damaging	Het
Anapc1	A	T	2: 128,659,788	L778Q	probably damaging	Het
Ankhd1	G	A	18: 36,644,527	A1588T	probably benign	Het
Anln	A	T	9: 22,353,331	L881Q	probably damaging	Het
Appl1	A	G	14: 26,927,749	S607P	probably damaging	Het
Arg2	G	T	12: 79,147,662	V87L	probably benign	Het
Atp13a2	C	T	4: 141,004,012	P869L	probably benign	Het
Atxn7l1	T	A	12: 33,358,770	D310E	probably damaging	Het
Cd6	A	T	19: 10,798,602	D164E	probably damaging	Het
Cdan1	C	A	2: 120,724,936	V775L	probably benign	Het
Cep164	A	T	9: 45,775,758		probably null	Het
Cep41	A	G	6: 30,661,006	S61P	probably damaging	Het
Clcn7	C	A	17: 25,160,471	D764E	probably damaging	Het
Cog2	G	A	8: 124,551,403	G703S	possibly damaging	Het
Cramp1l	T	C	17: 24,968,978	D1214G	probably damaging	Het
Cst7	G	T	2: 150,577,708	C98F	probably damaging	Het
Ctc1	T	A	11: 69,034,658	L1007Q	probably damaging	Het
Cyb5r4	G	A	9: 87,022,209	A11T	possibly damaging	Het
Dcaf8	A	G	1: 172,175,553	D306G	probably damaging	Het
Defb38	T	A	8: 19,023,576	K27I	probably benign	Het
Disp3	T	C	4: 148,271,632	E257G	probably damaging	Het
Dnajc6	T	C	4: 101,598,988	S58P	probably damaging	Het
Dock10	A	T	1: 80,606,568	D140E	possibly damaging	Het
Dopey1	T	C	9: 86,492,004	V172A	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Eci3	C	T	13: 34,953,028	A171T	possibly damaging	Het
Eml2	A	G	7: 19,194,061	D284G	probably damaging	Het
Eml5	T	C	12: 98,810,584	D1377G	probably damaging	Het
Fam186a	T	C	15: 99,940,302	E2687G	possibly damaging	Het
Fut9	A	C	4: 25,620,352	L154R	probably damaging	Het
Gabrb2	A	G	11: 42,626,713	N454S	probably benign	Het
Gm438	T	A	4: 144,777,883	M233L	probably benign	Het
Gpr183	T	A	14: 121,954,741	I123L	probably benign	Het
Gucy1b1	A	T	3: 82,058,352	N62K	probably benign	Het
Hcrtr2	T	C	9: 76,259,785	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,794	L2556Q	probably damaging	Het
Hfm1	T	A	5: 106,847,676	M1290L	probably benign	Het
Hgsnat	A	G	8: 25,957,256	W337R	probably benign	Het
Hmbox1	T	C	14: 64,828,648	Y291C	probably damaging	Het
Hmcn1	T	C	1: 150,721,664	N1749S	probably benign	Het
Igsf10	T	C	3: 59,331,272	D496G	possibly damaging	Het
Iqch	C	T	9: 63,534,337		probably null	Het
Irf6	A	G	1: 193,167,535	D255G	probably benign	Het
Kif9	G	A	9: 110,517,719	G642R	probably null	Het
Klhl20	A	G	1: 161,106,742	Y236H	probably benign	Het
Krt39	T	A	11: 99,519,088	K208*	probably null	Het
Lama3	T	A	18: 12,537,781	L808*	probably null	Het
Lrp5	C	T	19: 3,597,346	A1299T	probably benign	Het
Lysmd4	A	G	7: 67,226,231	Q214R	probably benign	Het
Macf1	T	A	4: 123,369,848	E6960V	probably damaging	Het
Mcpt2	A	G	14: 56,043,699	E120G	probably benign	Het
Mpeg1	A	G	19: 12,462,356	T393A	probably benign	Het
Myh4	G	A	11: 67,255,682	E1494K	probably damaging	Het
Nbas	T	G	12: 13,474,229	S1695R	possibly damaging	Het
Nlgn1	G	T	3: 25,440,037	Y249*	probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nup107	A	G	10: 117,750,906	L910P	probably damaging	Het
Obscn	T	A	11: 59,040,296	D5838V	probably damaging	Het
Olfr1218	G	A	2: 89,054,859	T189M	possibly damaging	Het
Olfr347	T	C	2: 36,734,345	I8T	probably benign	Het
Olfr926	T	C	9: 38,877,596	I140T	possibly damaging	Het
Olfr978	T	C	9: 39,994,359	I183T	probably benign	Het
Otogl	G	T	10: 107,854,264	S915Y	possibly damaging	Het
P2rx7	T	A	5: 122,681,032	C506S	probably damaging	Het
P4hb	T	C	11: 120,563,218	E350G	probably benign	Het
Papolg	A	T	11: 23,867,379	V606E	probably benign	Het
Pappa	A	T	4: 65,340,743	D1576V	probably damaging	Het
Pclo	G	T	5: 14,778,552	V1402F	probably damaging	Het
Pdcd11	A	G	19: 47,098,187	T211A	probably benign	Het
Pdzd2	T	C	15: 12,373,855	R2065G	possibly damaging	Het
Plcl2	T	C	17: 50,607,850	V629A	probably benign	Het
Prkcsh	G	A	9: 22,004,575	V92I	possibly damaging	Het
Prpf19	G	T	19: 10,902,416	V320F	probably damaging	Het
Ptpn3	T	A	4: 57,239,682	I283F	probably damaging	Het
Rcc2	T	A	4: 140,720,604	D480E	probably benign	Het
Rnf182	G	A	13: 43,668,042	C23Y	probably damaging	Het
Rnf186	C	T	4: 138,967,362	T71I	probably benign	Het
Scyl3	A	G	1: 163,933,696		probably null	Het
Slc1a2	C	A	2: 102,777,567	S520Y	probably damaging	Het
Slc35e2	T	A	4: 155,611,729	L191Q	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx33	T	C	9: 56,926,011	H258R	possibly damaging	Het
Tecpr2	A	T	12: 110,933,064	H622L	probably benign	Het
Thbs3	A	T	3: 89,226,406	E888D	probably damaging	Het
Tlk2	T	C	11: 105,221,298	L159P	probably benign	Het
Tmem70	A	T	1: 16,677,273	T205S	probably damaging	Het
Trappc10	T	A	10: 78,196,451	H1001L	probably benign	Het
Trim12a	T	C	7: 104,300,857	T292A	probably benign	Het
Trip11	G	A	12: 101,883,333	R92*	probably null	Het
Trpa1	G	A	1: 14,899,388	Q386*	probably null	Het
Trpc4	T	A	3: 54,279,989	V454D	probably damaging	Het
Ttc36	A	T	9: 44,802,754	D22E	probably benign	Het
Ttk	A	T	9: 83,869,263	I798F	probably damaging	Het
Ttn	T	C	2: 76,743,633	I17312V	probably damaging	Het
Txndc15	A	T	13: 55,718,062	E113V	possibly damaging	Het
Ube2d4	T	A	15: 58,846,599		noncoding transcript	Het
Urb1	T	A	16: 90,761,695	T1723S	probably benign	Het
Vmn1r65	A	T	7: 6,008,266	V323D	possibly damaging	Het
Vmn2r54	A	G	7: 12,632,311	M232T	probably benign	Het
Wdr59	A	G	8: 111,476,181	S577P	probably damaging	Het
Wfikkn2	C	T	11: 94,238,123	W397*	probably null	Het
Ypel1	T	A	16: 17,081,647		probably null	Het
Ythdf1	T	A	2: 180,910,970	D484V	probably damaging	Het
Zdhhc17	A	G	10: 110,947,293		probably null	Het
Zfp472	A	T	17: 32,965,913	H2L	possibly damaging	Het
Zfp953	A	T	13: 67,345,358	M74K	probably benign	Het
Zmat4	C	T	8: 23,929,135	T61M	probably benign	Het

Other mutations in Slc12a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01488:Slc12a6	APN	2	112353064	splice site	probably null
IGL02573:Slc12a6	APN	2	112358641	critical splice donor site	probably null
burgess	UTSW	2	112347317	missense	probably benign	0.09
petrified_forest	UTSW	2	112347426	missense	probably damaging	1.00
Prebiotic	UTSW	2	112352935	missense	probably benign	0.30
R0548:Slc12a6	UTSW	2	112335924	critical splice donor site	probably null
R1495:Slc12a6	UTSW	2	112354190	missense	probably damaging	0.99
R1726:Slc12a6	UTSW	2	112347426	missense	probably damaging	1.00
R1958:Slc12a6	UTSW	2	112355158	missense	possibly damaging	0.92
R2112:Slc12a6	UTSW	2	112356485	missense	probably damaging	1.00
R2865:Slc12a6	UTSW	2	112347317	missense	probably benign	0.09
R3888:Slc12a6	UTSW	2	112267030	missense	possibly damaging	0.76
R4412:Slc12a6	UTSW	2	112335888	missense	possibly damaging	0.95
R4655:Slc12a6	UTSW	2	112357766	critical splice acceptor site	probably null
R4669:Slc12a6	UTSW	2	112354295	missense	probably damaging	1.00
R4928:Slc12a6	UTSW	2	112352961	missense	probably damaging	1.00
R4974:Slc12a6	UTSW	2	112358525	missense	probably damaging	1.00
R5016:Slc12a6	UTSW	2	112356627	intron	probably benign
R5372:Slc12a6	UTSW	2	112347360	nonsense	probably null
R5405:Slc12a6	UTSW	2	112339379	missense	probably damaging	1.00
R5786:Slc12a6	UTSW	2	112284722	missense	probably benign	0.01
R5836:Slc12a6	UTSW	2	112341998	missense	possibly damaging	0.62
R6280:Slc12a6	UTSW	2	112337358	missense	probably damaging	1.00
R6310:Slc12a6	UTSW	2	112335839	missense	probably damaging	1.00
R6525:Slc12a6	UTSW	2	112352451	missense	probably damaging	1.00
R6597:Slc12a6	UTSW	2	112352935	missense	probably damaging	1.00
R6723:Slc12a6	UTSW	2	112337942	missense	probably damaging	1.00
R6895:Slc12a6	UTSW	2	112355095	missense	probably damaging	1.00
R7059:Slc12a6	UTSW	2	112352912	missense	probably damaging	0.99
R7188:Slc12a6	UTSW	2	112334415	missense	probably benign	0.04
R7395:Slc12a6	UTSW	2	112352542	missense	probably damaging	1.00
R7552:Slc12a6	UTSW	2	112341974	missense	probably damaging	1.00
R7992:Slc12a6	UTSW	2	112335911	missense	probably damaging	1.00
R8016:Slc12a6	UTSW	2	112356554	missense	probably benign	0.42
R8122:Slc12a6	UTSW	2	112266822	start codon destroyed	probably null
R8192:Slc12a6	UTSW	2	112351377	missense	probably damaging	1.00
R8222:Slc12a6	UTSW	2	112339525	splice site	probably null
R8534:Slc12a6	UTSW	2	112343967	missense	probably damaging	1.00
R9018:Slc12a6	UTSW	2	112344240	splice site	probably benign
R9281:Slc12a6	UTSW	2	112334409	missense	probably benign	0.00
R9418:Slc12a6	UTSW	2	112344210	missense
R9448:Slc12a6	UTSW	2	112349359	missense	probably damaging	1.00
R9460:Slc12a6	UTSW	2	112352935	missense	probably benign	0.30
R9694:Slc12a6	UTSW	2	112344536	missense	probably damaging	1.00
R9712:Slc12a6	UTSW	2	112356472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATCTTTTATGGCTATGGCTAAC -3'
(R):5'- GCCCTACCAACTTTATTTTCAGGAC -3'

Sequencing Primer
(F):5'- GGCTATGGCTAACTATATAATTTCCC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2014-06-23