Mutagenetix > Incidental Mutation

Incidental Mutation 'R1856:Anapc1'

206087

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

039880-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128659788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 778 (L778Q)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably damaging
Transcript: ENSMUST00000014499
AA Change: L778Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: L778Q

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110333
AA Change: L778Q

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: L778Q

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143007

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	G	7: 120,278,181	F1017L	probably damaging	Het
Abcb11	A	C	2: 69,245,923	V1147G	probably damaging	Het
Abcc10	T	A	17: 46,306,603	S1128C	probably damaging	Het
Adam6a	G	A	12: 113,545,303	C432Y	probably damaging	Het
Adamdec1	C	T	14: 68,570,948	V318M	probably damaging	Het
Ahnak	C	A	19: 9,002,048	S232Y	possibly damaging	Het
Amt	A	C	9: 108,297,162	H42P	probably damaging	Het
Ankhd1	G	A	18: 36,644,527	A1588T	probably benign	Het
Anln	A	T	9: 22,353,331	L881Q	probably damaging	Het
Appl1	A	G	14: 26,927,749	S607P	probably damaging	Het
Arg2	G	T	12: 79,147,662	V87L	probably benign	Het
Atp13a2	C	T	4: 141,004,012	P869L	probably benign	Het
Atxn7l1	T	A	12: 33,358,770	D310E	probably damaging	Het
Cd6	A	T	19: 10,798,602	D164E	probably damaging	Het
Cdan1	C	A	2: 120,724,936	V775L	probably benign	Het
Cep164	A	T	9: 45,775,758		probably null	Het
Cep41	A	G	6: 30,661,006	S61P	probably damaging	Het
Clcn7	C	A	17: 25,160,471	D764E	probably damaging	Het
Cog2	G	A	8: 124,551,403	G703S	possibly damaging	Het
Cramp1l	T	C	17: 24,968,978	D1214G	probably damaging	Het
Cst7	G	T	2: 150,577,708	C98F	probably damaging	Het
Ctc1	T	A	11: 69,034,658	L1007Q	probably damaging	Het
Cyb5r4	G	A	9: 87,022,209	A11T	possibly damaging	Het
Dcaf8	A	G	1: 172,175,553	D306G	probably damaging	Het
Defb38	T	A	8: 19,023,576	K27I	probably benign	Het
Disp3	T	C	4: 148,271,632	E257G	probably damaging	Het
Dnajc6	T	C	4: 101,598,988	S58P	probably damaging	Het
Dock10	A	T	1: 80,606,568	D140E	possibly damaging	Het
Dopey1	T	C	9: 86,492,004	V172A	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Eci3	C	T	13: 34,953,028	A171T	possibly damaging	Het
Eml2	A	G	7: 19,194,061	D284G	probably damaging	Het
Eml5	T	C	12: 98,810,584	D1377G	probably damaging	Het
Fam186a	T	C	15: 99,940,302	E2687G	possibly damaging	Het
Fut9	A	C	4: 25,620,352	L154R	probably damaging	Het
Gabrb2	A	G	11: 42,626,713	N454S	probably benign	Het
Gm438	T	A	4: 144,777,883	M233L	probably benign	Het
Gpr183	T	A	14: 121,954,741	I123L	probably benign	Het
Gucy1b1	A	T	3: 82,058,352	N62K	probably benign	Het
Hcrtr2	T	C	9: 76,259,785	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,794	L2556Q	probably damaging	Het
Hfm1	T	A	5: 106,847,676	M1290L	probably benign	Het
Hgsnat	A	G	8: 25,957,256	W337R	probably benign	Het
Hmbox1	T	C	14: 64,828,648	Y291C	probably damaging	Het
Hmcn1	T	C	1: 150,721,664	N1749S	probably benign	Het
Igsf10	T	C	3: 59,331,272	D496G	possibly damaging	Het
Iqch	C	T	9: 63,534,337		probably null	Het
Irf6	A	G	1: 193,167,535	D255G	probably benign	Het
Kif9	G	A	9: 110,517,719	G642R	probably null	Het
Klhl20	A	G	1: 161,106,742	Y236H	probably benign	Het
Krt39	T	A	11: 99,519,088	K208*	probably null	Het
Lama3	T	A	18: 12,537,781	L808*	probably null	Het
Lrp5	C	T	19: 3,597,346	A1299T	probably benign	Het
Lysmd4	A	G	7: 67,226,231	Q214R	probably benign	Het
Macf1	T	A	4: 123,369,848	E6960V	probably damaging	Het
Mcpt2	A	G	14: 56,043,699	E120G	probably benign	Het
Mpeg1	A	G	19: 12,462,356	T393A	probably benign	Het
Myh4	G	A	11: 67,255,682	E1494K	probably damaging	Het
Nbas	T	G	12: 13,474,229	S1695R	possibly damaging	Het
Nlgn1	G	T	3: 25,440,037	Y249*	probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nup107	A	G	10: 117,750,906	L910P	probably damaging	Het
Obscn	T	A	11: 59,040,296	D5838V	probably damaging	Het
Olfr1218	G	A	2: 89,054,859	T189M	possibly damaging	Het
Olfr347	T	C	2: 36,734,345	I8T	probably benign	Het
Olfr926	T	C	9: 38,877,596	I140T	possibly damaging	Het
Olfr978	T	C	9: 39,994,359	I183T	probably benign	Het
Otogl	G	T	10: 107,854,264	S915Y	possibly damaging	Het
P2rx7	T	A	5: 122,681,032	C506S	probably damaging	Het
P4hb	T	C	11: 120,563,218	E350G	probably benign	Het
Papolg	A	T	11: 23,867,379	V606E	probably benign	Het
Pappa	A	T	4: 65,340,743	D1576V	probably damaging	Het
Pclo	G	T	5: 14,778,552	V1402F	probably damaging	Het
Pdcd11	A	G	19: 47,098,187	T211A	probably benign	Het
Pdzd2	T	C	15: 12,373,855	R2065G	possibly damaging	Het
Plcl2	T	C	17: 50,607,850	V629A	probably benign	Het
Prkcsh	G	A	9: 22,004,575	V92I	possibly damaging	Het
Prpf19	G	T	19: 10,902,416	V320F	probably damaging	Het
Ptpn3	T	A	4: 57,239,682	I283F	probably damaging	Het
Rcc2	T	A	4: 140,720,604	D480E	probably benign	Het
Rnf182	G	A	13: 43,668,042	C23Y	probably damaging	Het
Rnf186	C	T	4: 138,967,362	T71I	probably benign	Het
Scyl3	A	G	1: 163,933,696		probably null	Het
Slc12a6	G	T	2: 112,335,927		probably null	Het
Slc1a2	C	A	2: 102,777,567	S520Y	probably damaging	Het
Slc35e2	T	A	4: 155,611,729	L191Q	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx33	T	C	9: 56,926,011	H258R	possibly damaging	Het
Tecpr2	A	T	12: 110,933,064	H622L	probably benign	Het
Thbs3	A	T	3: 89,226,406	E888D	probably damaging	Het
Tlk2	T	C	11: 105,221,298	L159P	probably benign	Het
Tmem70	A	T	1: 16,677,273	T205S	probably damaging	Het
Trappc10	T	A	10: 78,196,451	H1001L	probably benign	Het
Trim12a	T	C	7: 104,300,857	T292A	probably benign	Het
Trip11	G	A	12: 101,883,333	R92*	probably null	Het
Trpa1	G	A	1: 14,899,388	Q386*	probably null	Het
Trpc4	T	A	3: 54,279,989	V454D	probably damaging	Het
Ttc36	A	T	9: 44,802,754	D22E	probably benign	Het
Ttk	A	T	9: 83,869,263	I798F	probably damaging	Het
Ttn	T	C	2: 76,743,633	I17312V	probably damaging	Het
Txndc15	A	T	13: 55,718,062	E113V	possibly damaging	Het
Ube2d4	T	A	15: 58,846,599		noncoding transcript	Het
Urb1	T	A	16: 90,761,695	T1723S	probably benign	Het
Vmn1r65	A	T	7: 6,008,266	V323D	possibly damaging	Het
Vmn2r54	A	G	7: 12,632,311	M232T	probably benign	Het
Wdr59	A	G	8: 111,476,181	S577P	probably damaging	Het
Wfikkn2	C	T	11: 94,238,123	W397*	probably null	Het
Ypel1	T	A	16: 17,081,647		probably null	Het
Ythdf1	T	A	2: 180,910,970	D484V	probably damaging	Het
Zdhhc17	A	G	10: 110,947,293		probably null	Het
Zfp472	A	T	17: 32,965,913	H2L	possibly damaging	Het
Zfp953	A	T	13: 67,345,358	M74K	probably benign	Het
Zmat4	C	T	8: 23,929,135	T61M	probably benign	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
R9516:Anapc1	UTSW	2	128675713	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128664060	nonsense	probably null
R9572:Anapc1	UTSW	2	128664056	missense	probably benign
R9757:Anapc1	UTSW	2	128675756	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128658301	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGCTAAAGGCGCACACATATCC -3'
(R):5'- GTACCATCGCAATGTTGAGTC -3'

Sequencing Primer
(F):5'- CAACAGTTTTATGTTTGCAGGC -3'
(R):5'- GTACCATCGCAATGTTGAGTCTCATC -3'

Posted On

2014-06-23