Mutagenetix > Incidental Mutations

Incidental Mutation 'R1856:Trpc4'

206091

Institutional Source

Beutler Lab

Gene Symbol

Trpc4

Ensembl Gene

ENSMUSG00000027748

Gene Name

transient receptor potential cation channel, subfamily C, member 4

Synonyms

Trrp4, STRPC4, Trp4, CCE1

MMRRC Submission

039880-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R1856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54156035-54318471 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54279989 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 454 (V454D)

Ref Sequence

ENSEMBL: ENSMUSP00000143593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029311
AA Change: V454D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: V454D

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	4e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	1.2e-30	PFAM
transmembrane domain	328	350	N/A	INTRINSIC
Pfam:Ion_trans	363	632	4.2e-33	PFAM
low complexity region	763	780	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200048
AA Change: V454D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: V454D

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	2e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	1.1e-30	PFAM
transmembrane domain	328	350	N/A	INTRINSIC
Pfam:Ion_trans	363	632	3.5e-33	PFAM
low complexity region	763	782	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200341

SMART Domains

Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

Domain	Start	End	E-Value	Type
Blast:ANK	33	63	2e-7	BLAST
ANK	69	98	8.72e-1	SMART
ANK	141	170	5.09e-2	SMART
Pfam:TRP_2	176	238	6.4e-33	PFAM
transmembrane domain	331	351	N/A	INTRINSIC
transmembrane domain	366	383	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	G	7: 120,278,181	F1017L	probably damaging	Het
Abcb11	A	C	2: 69,245,923	V1147G	probably damaging	Het
Abcc10	T	A	17: 46,306,603	S1128C	probably damaging	Het
Adam6a	G	A	12: 113,545,303	C432Y	probably damaging	Het
Adamdec1	C	T	14: 68,570,948	V318M	probably damaging	Het
Ahnak	C	A	19: 9,002,048	S232Y	possibly damaging	Het
Amt	A	C	9: 108,297,162	H42P	probably damaging	Het
Anapc1	A	T	2: 128,659,788	L778Q	probably damaging	Het
Ankhd1	G	A	18: 36,644,527	A1588T	probably benign	Het
Anln	A	T	9: 22,353,331	L881Q	probably damaging	Het
Appl1	A	G	14: 26,927,749	S607P	probably damaging	Het
Arg2	G	T	12: 79,147,662	V87L	probably benign	Het
Atp13a2	C	T	4: 141,004,012	P869L	probably benign	Het
Atxn7l1	T	A	12: 33,358,770	D310E	probably damaging	Het
Cd6	A	T	19: 10,798,602	D164E	probably damaging	Het
Cdan1	C	A	2: 120,724,936	V775L	probably benign	Het
Cep164	A	T	9: 45,775,758		probably null	Het
Cep41	A	G	6: 30,661,006	S61P	probably damaging	Het
Clcn7	C	A	17: 25,160,471	D764E	probably damaging	Het
Cog2	G	A	8: 124,551,403	G703S	possibly damaging	Het
Cramp1l	T	C	17: 24,968,978	D1214G	probably damaging	Het
Cst7	G	T	2: 150,577,708	C98F	probably damaging	Het
Ctc1	T	A	11: 69,034,658	L1007Q	probably damaging	Het
Cyb5r4	G	A	9: 87,022,209	A11T	possibly damaging	Het
Dcaf8	A	G	1: 172,175,553	D306G	probably damaging	Het
Defb38	T	A	8: 19,023,576	K27I	probably benign	Het
Disp3	T	C	4: 148,271,632	E257G	probably damaging	Het
Dnajc6	T	C	4: 101,598,988	S58P	probably damaging	Het
Dock10	A	T	1: 80,606,568	D140E	possibly damaging	Het
Dopey1	T	C	9: 86,492,004	V172A	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Eci3	C	T	13: 34,953,028	A171T	possibly damaging	Het
Eml2	A	G	7: 19,194,061	D284G	probably damaging	Het
Eml5	T	C	12: 98,810,584	D1377G	probably damaging	Het
Fam186a	T	C	15: 99,940,302	E2687G	possibly damaging	Het
Fut9	A	C	4: 25,620,352	L154R	probably damaging	Het
Gabrb2	A	G	11: 42,626,713	N454S	probably benign	Het
Gm438	T	A	4: 144,777,883	M233L	probably benign	Het
Gpr183	T	A	14: 121,954,741	I123L	probably benign	Het
Gucy1b1	A	T	3: 82,058,352	N62K	probably benign	Het
Hcrtr2	T	C	9: 76,259,785	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,794	L2556Q	probably damaging	Het
Hfm1	T	A	5: 106,847,676	M1290L	probably benign	Het
Hgsnat	A	G	8: 25,957,256	W337R	probably benign	Het
Hmbox1	T	C	14: 64,828,648	Y291C	probably damaging	Het
Hmcn1	T	C	1: 150,721,664	N1749S	probably benign	Het
Igsf10	T	C	3: 59,331,272	D496G	possibly damaging	Het
Iqch	C	T	9: 63,534,337		probably null	Het
Irf6	A	G	1: 193,167,535	D255G	probably benign	Het
Kif9	G	A	9: 110,517,719	G642R	probably null	Het
Klhl20	A	G	1: 161,106,742	Y236H	probably benign	Het
Krt39	T	A	11: 99,519,088	K208*	probably null	Het
Lama3	T	A	18: 12,537,781	L808*	probably null	Het
Lrp5	C	T	19: 3,597,346	A1299T	probably benign	Het
Lysmd4	A	G	7: 67,226,231	Q214R	probably benign	Het
Macf1	T	A	4: 123,369,848	E6960V	probably damaging	Het
Mcpt2	A	G	14: 56,043,699	E120G	probably benign	Het
Mpeg1	A	G	19: 12,462,356	T393A	probably benign	Het
Myh4	G	A	11: 67,255,682	E1494K	probably damaging	Het
Nbas	T	G	12: 13,474,229	S1695R	possibly damaging	Het
Nlgn1	G	T	3: 25,440,037	Y249*	probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nup107	A	G	10: 117,750,906	L910P	probably damaging	Het
Obscn	T	A	11: 59,040,296	D5838V	probably damaging	Het
Olfr1218	G	A	2: 89,054,859	T189M	possibly damaging	Het
Olfr347	T	C	2: 36,734,345	I8T	probably benign	Het
Olfr926	T	C	9: 38,877,596	I140T	possibly damaging	Het
Olfr978	T	C	9: 39,994,359	I183T	probably benign	Het
Otogl	G	T	10: 107,854,264	S915Y	possibly damaging	Het
P2rx7	T	A	5: 122,681,032	C506S	probably damaging	Het
P4hb	T	C	11: 120,563,218	E350G	probably benign	Het
Papolg	A	T	11: 23,867,379	V606E	probably benign	Het
Pappa	A	T	4: 65,340,743	D1576V	probably damaging	Het
Pclo	G	T	5: 14,778,552	V1402F	probably damaging	Het
Pdcd11	A	G	19: 47,098,187	T211A	probably benign	Het
Pdzd2	T	C	15: 12,373,855	R2065G	possibly damaging	Het
Plcl2	T	C	17: 50,607,850	V629A	probably benign	Het
Prkcsh	G	A	9: 22,004,575	V92I	possibly damaging	Het
Prpf19	G	T	19: 10,902,416	V320F	probably damaging	Het
Ptpn3	T	A	4: 57,239,682	I283F	probably damaging	Het
Rcc2	T	A	4: 140,720,604	D480E	probably benign	Het
Rnf182	G	A	13: 43,668,042	C23Y	probably damaging	Het
Rnf186	C	T	4: 138,967,362	T71I	probably benign	Het
Scyl3	A	G	1: 163,933,696		probably null	Het
Slc12a6	G	T	2: 112,335,927		probably null	Het
Slc1a2	C	A	2: 102,777,567	S520Y	probably damaging	Het
Slc35e2	T	A	4: 155,611,729	L191Q	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx33	T	C	9: 56,926,011	H258R	possibly damaging	Het
Tecpr2	A	T	12: 110,933,064	H622L	probably benign	Het
Thbs3	A	T	3: 89,226,406	E888D	probably damaging	Het
Tlk2	T	C	11: 105,221,298	L159P	probably benign	Het
Tmem70	A	T	1: 16,677,273	T205S	probably damaging	Het
Trappc10	T	A	10: 78,196,451	H1001L	probably benign	Het
Trim12a	T	C	7: 104,300,857	T292A	probably benign	Het
Trip11	G	A	12: 101,883,333	R92*	probably null	Het
Trpa1	G	A	1: 14,899,388	Q386*	probably null	Het
Ttc36	A	T	9: 44,802,754	D22E	probably benign	Het
Ttk	A	T	9: 83,869,263	I798F	probably damaging	Het
Ttn	T	C	2: 76,743,633	I17312V	probably damaging	Het
Txndc15	A	T	13: 55,718,062	E113V	possibly damaging	Het
Ube2d4	T	A	15: 58,846,599		noncoding transcript	Het
Urb1	T	A	16: 90,761,695	T1723S	probably benign	Het
Vmn1r65	A	T	7: 6,008,266	V323D	possibly damaging	Het
Vmn2r54	A	G	7: 12,632,311	M232T	probably benign	Het
Wdr59	A	G	8: 111,476,181	S577P	probably damaging	Het
Wfikkn2	C	T	11: 94,238,123	W397*	probably null	Het
Ypel1	T	A	16: 17,081,647		probably null	Het
Ythdf1	T	A	2: 180,910,970	D484V	probably damaging	Het
Zdhhc17	A	G	10: 110,947,293		probably null	Het
Zfp472	A	T	17: 32,965,913	H2L	possibly damaging	Het
Zfp953	A	T	13: 67,345,358	M74K	probably benign	Het
Zmat4	C	T	8: 23,929,135	T61M	probably benign	Het

Other mutations in Trpc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Trpc4	APN	3	54302175	missense	probably damaging	1.00
IGL01067:Trpc4	APN	3	54222562	missense	probably benign	0.01
IGL01475:Trpc4	APN	3	54266407	missense	possibly damaging	0.87
IGL01544:Trpc4	APN	3	54302146	missense	probably damaging	0.99
IGL01688:Trpc4	APN	3	54266074	splice site	probably benign
IGL02134:Trpc4	APN	3	54315654	missense	possibly damaging	0.46
IGL02237:Trpc4	APN	3	54222362	missense	probably damaging	1.00
IGL02301:Trpc4	APN	3	54291232	missense	probably damaging	0.97
IGL02549:Trpc4	APN	3	54222349	missense	possibly damaging	0.92
IGL02742:Trpc4	APN	3	54299246	missense	probably damaging	1.00
IGL02815:Trpc4	APN	3	54299274	splice site	probably benign
R0498:Trpc4	UTSW	3	54291211	missense	probably damaging	1.00
R0555:Trpc4	UTSW	3	54302090	splice site	probably benign
R0609:Trpc4	UTSW	3	54194768	missense	probably damaging	1.00
R1351:Trpc4	UTSW	3	54195002	missense	probably damaging	1.00
R1595:Trpc4	UTSW	3	54315815	missense	probably benign	0.02
R1623:Trpc4	UTSW	3	54299179	missense	probably damaging	1.00
R1763:Trpc4	UTSW	3	54194822	missense	possibly damaging	0.90
R1843:Trpc4	UTSW	3	54279994	missense	probably benign	0.19
R1936:Trpc4	UTSW	3	54279890	missense	probably damaging	1.00
R2196:Trpc4	UTSW	3	54302193	missense	probably benign	0.03
R2441:Trpc4	UTSW	3	54222283	missense	probably damaging	0.96
R2877:Trpc4	UTSW	3	54291340	missense	probably damaging	1.00
R3846:Trpc4	UTSW	3	54318012	missense	probably benign	0.22
R3931:Trpc4	UTSW	3	54318095	missense	probably damaging	1.00
R4854:Trpc4	UTSW	3	54302218	missense	probably damaging	1.00
R5024:Trpc4	UTSW	3	54194796	missense	probably benign	0.11
R5284:Trpc4	UTSW	3	54279947	missense	probably damaging	0.99
R5320:Trpc4	UTSW	3	54299178	missense	probably damaging	0.99
R5973:Trpc4	UTSW	3	54315842	missense	probably damaging	1.00
R6276:Trpc4	UTSW	3	54318020	missense	probably benign	0.25
R6335:Trpc4	UTSW	3	54317574	critical splice donor site	probably null
R7082:Trpc4	UTSW	3	54299098	nonsense	probably null
R7215:Trpc4	UTSW	3	54194896	missense	possibly damaging	0.83
R7299:Trpc4	UTSW	3	54317627	missense	possibly damaging	0.87
R7423:Trpc4	UTSW	3	54318029	missense	probably benign
R7459:Trpc4	UTSW	3	54291232	missense	probably damaging	0.97
R7538:Trpc4	UTSW	3	54318095	missense	possibly damaging	0.92
R7542:Trpc4	UTSW	3	54315654	missense	probably damaging	1.00
R7823:Trpc4	UTSW	3	54302219	nonsense	probably null
R7868:Trpc4	UTSW	3	54302286	missense	probably benign	0.00
R8046:Trpc4	UTSW	3	54194914	missense	probably damaging	1.00
R8164:Trpc4	UTSW	3	54315805	missense	probably benign	0.31
R8235:Trpc4	UTSW	3	54302248	missense	probably benign	0.01
R8263:Trpc4	UTSW	3	54222335	missense	probably damaging	0.99
R8438:Trpc4	UTSW	3	54222253	missense	possibly damaging	0.90
X0066:Trpc4	UTSW	3	54194750	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTGAAAGTCCCACTTACGG -3'
(R):5'- CGAGGCAGTCATGTTAATTAGCAG -3'

Sequencing Primer
(F):5'- CGGTGAATTTCTCTATAATTGCAGG -3'
(R):5'- GCAGCTTTGATGTGCTTATAACAGC -3'

Posted On

2014-06-23