Incidental Mutation 'R1856:Thbs3'
ID206094
Institutional Source Beutler Lab
Gene Symbol Thbs3
Ensembl Gene ENSMUSG00000028047
Gene Namethrombospondin 3
SynonymsThbs-3, TSP3
MMRRC Submission 039880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89215180-89226837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89226406 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 888 (E888D)
Ref Sequence ENSEMBL: ENSMUSP00000112912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000041142] [ENSMUST00000119084] [ENSMUST00000174126]
Predicted Effect probably damaging
Transcript: ENSMUST00000029682
AA Change: E925D

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047
AA Change: E925D

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041142
SMART Domains Protein: ENSMUSP00000041963
Gene: ENSMUSG00000042784

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
internal_repeat_2 48 106 4.93e-6 PROSPERO
internal_repeat_1 79 151 3.46e-38 PROSPERO
low complexity region 153 181 N/A INTRINSIC
internal_repeat_1 183 254 3.46e-38 PROSPERO
internal_repeat_2 192 259 4.93e-6 PROSPERO
low complexity region 277 292 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
low complexity region 382 400 N/A INTRINSIC
SEA 412 528 6.2e-43 SMART
low complexity region 537 552 N/A INTRINSIC
Blast:SEA 557 624 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102300
Predicted Effect probably damaging
Transcript: ENSMUST00000119084
AA Change: E888D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047
AA Change: E888D

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126700
Predicted Effect probably benign
Transcript: ENSMUST00000136881
SMART Domains Protein: ENSMUSP00000120337
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
Pfam:TSP_3 1 31 5.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155924
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174324
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice at a young age are heavier and exhibit femurs with increased periosteal and endocortical diameters, greater moments of inertia and increased bending strength and failure loads, with these defects no longer detected in older mice. Femoral heads show accelerated bone ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Thbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Thbs3 APN 3 89219058 nonsense probably null
IGL02927:Thbs3 APN 3 89220207 missense probably damaging 0.98
IGL02980:Thbs3 UTSW 3 89223144 missense probably benign
R0648:Thbs3 UTSW 3 89216665 intron probably null
R0690:Thbs3 UTSW 3 89220165 missense possibly damaging 0.50
R1928:Thbs3 UTSW 3 89217760 missense probably damaging 1.00
R2116:Thbs3 UTSW 3 89219392 missense probably damaging 1.00
R4600:Thbs3 UTSW 3 89224590 missense probably damaging 0.97
R4719:Thbs3 UTSW 3 89216840 missense probably damaging 1.00
R4947:Thbs3 UTSW 3 89226431 missense probably damaging 1.00
R4989:Thbs3 UTSW 3 89223102 intron probably benign
R5134:Thbs3 UTSW 3 89223102 intron probably benign
R5217:Thbs3 UTSW 3 89223164 critical splice donor site probably null
R5305:Thbs3 UTSW 3 89217976 intron probably benign
R5354:Thbs3 UTSW 3 89221377 missense probably damaging 1.00
R5444:Thbs3 UTSW 3 89223385 intron probably benign
R5569:Thbs3 UTSW 3 89219463 missense probably damaging 1.00
R5646:Thbs3 UTSW 3 89219098 missense probably damaging 1.00
R5801:Thbs3 UTSW 3 89224397 missense probably benign 0.15
R5886:Thbs3 UTSW 3 89220163 missense probably damaging 1.00
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6943:Thbs3 UTSW 3 89224864 missense probably benign 0.01
R7017:Thbs3 UTSW 3 89224415 missense probably damaging 1.00
R7352:Thbs3 UTSW 3 89225280 missense probably benign 0.03
R7570:Thbs3 UTSW 3 89219052 nonsense probably null
R7671:Thbs3 UTSW 3 89216707 missense probably benign 0.01
R7707:Thbs3 UTSW 3 89224900 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCCCTCAGGACTAGAGAGC -3'
(R):5'- GTTCAATGGCCAAAGGTCTCC -3'

Sequencing Primer
(F):5'- TCAGGACTAGAGAGCCCCAG -3'
(R):5'- ATGGCCAAAGGTCTCCGATCAG -3'
Posted On2014-06-23