Incidental Mutation 'R1856:Thbs3'
ID 206094
Institutional Source Beutler Lab
Gene Symbol Thbs3
Ensembl Gene ENSMUSG00000028047
Gene Name thrombospondin 3
Synonyms TSP3, Thbs-3
MMRRC Submission 039880-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.558) question?
Stock # R1856 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 89122487-89134144 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89133713 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 888 (E888D)
Ref Sequence ENSEMBL: ENSMUSP00000112912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000041142] [ENSMUST00000119084] [ENSMUST00000174126]
AlphaFold Q05895
Predicted Effect probably damaging
Transcript: ENSMUST00000029682
AA Change: E925D

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047
AA Change: E925D

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041142
SMART Domains Protein: ENSMUSP00000041963
Gene: ENSMUSG00000042784

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
internal_repeat_2 48 106 4.93e-6 PROSPERO
internal_repeat_1 79 151 3.46e-38 PROSPERO
low complexity region 153 181 N/A INTRINSIC
internal_repeat_1 183 254 3.46e-38 PROSPERO
internal_repeat_2 192 259 4.93e-6 PROSPERO
low complexity region 277 292 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
low complexity region 382 400 N/A INTRINSIC
SEA 412 528 6.2e-43 SMART
low complexity region 537 552 N/A INTRINSIC
Blast:SEA 557 624 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102300
Predicted Effect probably damaging
Transcript: ENSMUST00000119084
AA Change: E888D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047
AA Change: E888D

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155924
Predicted Effect probably benign
Transcript: ENSMUST00000136881
SMART Domains Protein: ENSMUSP00000120337
Gene: ENSMUSG00000028047

DomainStartEndE-ValueType
Pfam:TSP_3 1 31 5.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice at a young age are heavier and exhibit femurs with increased periosteal and endocortical diameters, greater moments of inertia and increased bending strength and failure loads, with these defects no longer detected in older mice. Femoral heads show accelerated bone ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,504,453 (GRCm39) M233L probably benign Het
Abca14 T G 7: 119,877,404 (GRCm39) F1017L probably damaging Het
Abcb11 A C 2: 69,076,267 (GRCm39) V1147G probably damaging Het
Abcc10 T A 17: 46,617,529 (GRCm39) S1128C probably damaging Het
Adam6a G A 12: 113,508,923 (GRCm39) C432Y probably damaging Het
Adamdec1 C T 14: 68,808,397 (GRCm39) V318M probably damaging Het
Ahnak C A 19: 8,979,412 (GRCm39) S232Y possibly damaging Het
Amt A C 9: 108,174,361 (GRCm39) H42P probably damaging Het
Anapc1 A T 2: 128,501,708 (GRCm39) L778Q probably damaging Het
Ankhd1 G A 18: 36,777,580 (GRCm39) A1588T probably benign Het
Anln A T 9: 22,264,627 (GRCm39) L881Q probably damaging Het
Appl1 A G 14: 26,649,706 (GRCm39) S607P probably damaging Het
Arg2 G T 12: 79,194,436 (GRCm39) V87L probably benign Het
Atp13a2 C T 4: 140,731,323 (GRCm39) P869L probably benign Het
Atxn7l1 T A 12: 33,408,769 (GRCm39) D310E probably damaging Het
Cd6 A T 19: 10,775,966 (GRCm39) D164E probably damaging Het
Cdan1 C A 2: 120,555,417 (GRCm39) V775L probably benign Het
Cep164 A T 9: 45,687,056 (GRCm39) probably null Het
Cep41 A G 6: 30,661,005 (GRCm39) S61P probably damaging Het
Clcn7 C A 17: 25,379,445 (GRCm39) D764E probably damaging Het
Cog2 G A 8: 125,278,142 (GRCm39) G703S possibly damaging Het
Cramp1 T C 17: 25,187,952 (GRCm39) D1214G probably damaging Het
Cst7 G T 2: 150,419,628 (GRCm39) C98F probably damaging Het
Ctc1 T A 11: 68,925,484 (GRCm39) L1007Q probably damaging Het
Cyb5r4 G A 9: 86,904,262 (GRCm39) A11T possibly damaging Het
Dcaf8 A G 1: 172,003,120 (GRCm39) D306G probably damaging Het
Defb38 T A 8: 19,073,592 (GRCm39) K27I probably benign Het
Disp3 T C 4: 148,356,089 (GRCm39) E257G probably damaging Het
Dnajc6 T C 4: 101,456,185 (GRCm39) S58P probably damaging Het
Dock10 A T 1: 80,584,285 (GRCm39) D140E possibly damaging Het
Dop1a T C 9: 86,374,057 (GRCm39) V172A probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Eci3 C T 13: 35,137,011 (GRCm39) A171T possibly damaging Het
Eml2 A G 7: 18,927,986 (GRCm39) D284G probably damaging Het
Eml5 T C 12: 98,776,843 (GRCm39) D1377G probably damaging Het
Fam186a T C 15: 99,838,183 (GRCm39) E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 (GRCm39) L154R probably damaging Het
Gabrb2 A G 11: 42,517,540 (GRCm39) N454S probably benign Het
Gpr183 T A 14: 122,192,153 (GRCm39) I123L probably benign Het
Gucy1b1 A T 3: 81,965,659 (GRCm39) N62K probably benign Het
Hcrtr2 T C 9: 76,167,067 (GRCm39) N90S probably damaging Het
Hectd1 A T 12: 51,791,577 (GRCm39) L2556Q probably damaging Het
Hfm1 T A 5: 106,995,542 (GRCm39) M1290L probably benign Het
Hgsnat A G 8: 26,447,284 (GRCm39) W337R probably benign Het
Hmbox1 T C 14: 65,066,097 (GRCm39) Y291C probably damaging Het
Hmcn1 T C 1: 150,597,415 (GRCm39) N1749S probably benign Het
Igsf10 T C 3: 59,238,693 (GRCm39) D496G possibly damaging Het
Iqch C T 9: 63,441,619 (GRCm39) probably null Het
Irf6 A G 1: 192,849,843 (GRCm39) D255G probably benign Het
Kif9 G A 9: 110,346,787 (GRCm39) G642R probably null Het
Klhl20 A G 1: 160,934,312 (GRCm39) Y236H probably benign Het
Krt39 T A 11: 99,409,914 (GRCm39) K208* probably null Het
Lama3 T A 18: 12,670,838 (GRCm39) L808* probably null Het
Lrp5 C T 19: 3,647,346 (GRCm39) A1299T probably benign Het
Lysmd4 A G 7: 66,875,979 (GRCm39) Q214R probably benign Het
Macf1 T A 4: 123,263,641 (GRCm39) E6960V probably damaging Het
Mcpt2 A G 14: 56,281,156 (GRCm39) E120G probably benign Het
Mpeg1 A G 19: 12,439,720 (GRCm39) T393A probably benign Het
Myh4 G A 11: 67,146,508 (GRCm39) E1494K probably damaging Het
Nbas T G 12: 13,524,230 (GRCm39) S1695R possibly damaging Het
Nlgn1 G T 3: 25,494,201 (GRCm39) Y249* probably null Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nup107 A G 10: 117,586,811 (GRCm39) L910P probably damaging Het
Obscn T A 11: 58,931,122 (GRCm39) D5838V probably damaging Het
Or10g7 T C 9: 39,905,655 (GRCm39) I183T probably benign Het
Or1j18 T C 2: 36,624,357 (GRCm39) I8T probably benign Het
Or4c113 G A 2: 88,885,203 (GRCm39) T189M possibly damaging Het
Or8d2b T C 9: 38,788,892 (GRCm39) I140T possibly damaging Het
Otogl G T 10: 107,690,125 (GRCm39) S915Y possibly damaging Het
P2rx7 T A 5: 122,819,095 (GRCm39) C506S probably damaging Het
P4hb T C 11: 120,454,044 (GRCm39) E350G probably benign Het
Papolg A T 11: 23,817,379 (GRCm39) V606E probably benign Het
Pappa A T 4: 65,258,980 (GRCm39) D1576V probably damaging Het
Pclo G T 5: 14,828,566 (GRCm39) V1402F probably damaging Het
Pdcd11 A G 19: 47,086,626 (GRCm39) T211A probably benign Het
Pdzd2 T C 15: 12,373,941 (GRCm39) R2065G possibly damaging Het
Plcl2 T C 17: 50,914,878 (GRCm39) V629A probably benign Het
Prkcsh G A 9: 21,915,871 (GRCm39) V92I possibly damaging Het
Prpf19 G T 19: 10,879,780 (GRCm39) V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 (GRCm39) I283F probably damaging Het
Rcc2 T A 4: 140,447,915 (GRCm39) D480E probably benign Het
Rnf182 G A 13: 43,821,518 (GRCm39) C23Y probably damaging Het
Rnf186 C T 4: 138,694,673 (GRCm39) T71I probably benign Het
Scyl3 A G 1: 163,761,265 (GRCm39) probably null Het
Slc12a6 G T 2: 112,166,272 (GRCm39) probably null Het
Slc1a2 C A 2: 102,607,912 (GRCm39) S520Y probably damaging Het
Slc35e2 T A 4: 155,696,186 (GRCm39) L191Q probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx33 T C 9: 56,833,295 (GRCm39) H258R possibly damaging Het
Tecpr2 A T 12: 110,899,498 (GRCm39) H622L probably benign Het
Tlk2 T C 11: 105,112,124 (GRCm39) L159P probably benign Het
Tmem70 A T 1: 16,747,497 (GRCm39) T205S probably damaging Het
Trappc10 T A 10: 78,032,285 (GRCm39) H1001L probably benign Het
Trim12a T C 7: 103,950,064 (GRCm39) T292A probably benign Het
Trip11 G A 12: 101,849,592 (GRCm39) R92* probably null Het
Trpa1 G A 1: 14,969,612 (GRCm39) Q386* probably null Het
Trpc4 T A 3: 54,187,410 (GRCm39) V454D probably damaging Het
Ttc36 A T 9: 44,714,051 (GRCm39) D22E probably benign Het
Ttk A T 9: 83,751,316 (GRCm39) I798F probably damaging Het
Ttn T C 2: 76,573,977 (GRCm39) I17312V probably damaging Het
Txndc15 A T 13: 55,865,875 (GRCm39) E113V possibly damaging Het
Ube2d4 T A 15: 58,718,448 (GRCm39) noncoding transcript Het
Urb1 T A 16: 90,558,583 (GRCm39) T1723S probably benign Het
Vmn1r65 A T 7: 6,011,265 (GRCm39) V323D possibly damaging Het
Vmn2r54 A G 7: 12,366,238 (GRCm39) M232T probably benign Het
Wdr59 A G 8: 112,202,813 (GRCm39) S577P probably damaging Het
Wfikkn2 C T 11: 94,128,949 (GRCm39) W397* probably null Het
Ypel1 T A 16: 16,899,511 (GRCm39) probably null Het
Ythdf1 T A 2: 180,552,763 (GRCm39) D484V probably damaging Het
Zdhhc17 A G 10: 110,783,154 (GRCm39) probably null Het
Zfp472 A T 17: 33,184,887 (GRCm39) H2L possibly damaging Het
Zfp953 A T 13: 67,493,422 (GRCm39) M74K probably benign Het
Zmat4 C T 8: 24,419,151 (GRCm39) T61M probably benign Het
Other mutations in Thbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Thbs3 APN 3 89,126,365 (GRCm39) nonsense probably null
IGL02927:Thbs3 APN 3 89,127,514 (GRCm39) missense probably damaging 0.98
IGL02980:Thbs3 UTSW 3 89,130,451 (GRCm39) missense probably benign
R0648:Thbs3 UTSW 3 89,123,972 (GRCm39) splice site probably null
R0690:Thbs3 UTSW 3 89,127,472 (GRCm39) missense possibly damaging 0.50
R1928:Thbs3 UTSW 3 89,125,067 (GRCm39) missense probably damaging 1.00
R2116:Thbs3 UTSW 3 89,126,699 (GRCm39) missense probably damaging 1.00
R4600:Thbs3 UTSW 3 89,131,897 (GRCm39) missense probably damaging 0.97
R4719:Thbs3 UTSW 3 89,124,147 (GRCm39) missense probably damaging 1.00
R4947:Thbs3 UTSW 3 89,133,738 (GRCm39) missense probably damaging 1.00
R4989:Thbs3 UTSW 3 89,130,409 (GRCm39) intron probably benign
R5134:Thbs3 UTSW 3 89,130,409 (GRCm39) intron probably benign
R5217:Thbs3 UTSW 3 89,130,471 (GRCm39) critical splice donor site probably null
R5305:Thbs3 UTSW 3 89,125,283 (GRCm39) intron probably benign
R5354:Thbs3 UTSW 3 89,128,684 (GRCm39) missense probably damaging 1.00
R5444:Thbs3 UTSW 3 89,130,692 (GRCm39) intron probably benign
R5569:Thbs3 UTSW 3 89,126,770 (GRCm39) missense probably damaging 1.00
R5646:Thbs3 UTSW 3 89,126,405 (GRCm39) missense probably damaging 1.00
R5801:Thbs3 UTSW 3 89,131,704 (GRCm39) missense probably benign 0.15
R5886:Thbs3 UTSW 3 89,127,470 (GRCm39) missense probably damaging 1.00
R6031:Thbs3 UTSW 3 89,125,401 (GRCm39) missense probably damaging 0.99
R6031:Thbs3 UTSW 3 89,125,401 (GRCm39) missense probably damaging 0.99
R6943:Thbs3 UTSW 3 89,132,171 (GRCm39) missense probably benign 0.01
R7017:Thbs3 UTSW 3 89,131,722 (GRCm39) missense probably damaging 1.00
R7352:Thbs3 UTSW 3 89,132,587 (GRCm39) missense probably benign 0.03
R7570:Thbs3 UTSW 3 89,126,359 (GRCm39) nonsense probably null
R7671:Thbs3 UTSW 3 89,124,014 (GRCm39) missense probably benign 0.01
R7707:Thbs3 UTSW 3 89,132,207 (GRCm39) missense possibly damaging 0.88
R8255:Thbs3 UTSW 3 89,132,565 (GRCm39) missense probably benign
R8341:Thbs3 UTSW 3 89,132,698 (GRCm39) missense probably benign
R8769:Thbs3 UTSW 3 89,131,937 (GRCm39) intron probably benign
R9536:Thbs3 UTSW 3 89,124,044 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTCCCTCAGGACTAGAGAGC -3'
(R):5'- GTTCAATGGCCAAAGGTCTCC -3'

Sequencing Primer
(F):5'- TCAGGACTAGAGAGCCCCAG -3'
(R):5'- ATGGCCAAAGGTCTCCGATCAG -3'
Posted On 2014-06-23