Mutagenetix > Incidental Mutation

Incidental Mutation 'R1856:Ptpn3'

206097

Institutional Source

Beutler Lab

Gene Symbol

Ptpn3

Ensembl Gene

ENSMUSG00000038764

Gene Name

protein tyrosine phosphatase, non-receptor type 3

Synonyms

9530011I20Rik, PTPCL, PTP-H1

MMRRC Submission

039880-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.491) question?

Stock #

R1856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57190841-57301837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57239682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 283 (I283F)

Ref Sequence

ENSEMBL: ENSMUSP00000075063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075637]

AlphaFold

A2ALK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000075637
AA Change: I283F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: I283F

Domain	Start	End	E-Value	Type
B41	25	222	2.44e-67	SMART
FERM_C	226	316	2.64e-25	SMART
low complexity region	454	470	N/A	INTRINSIC
PDZ	519	598	1.65e-15	SMART
PTPc	645	903	5.66e-117	SMART

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	G	7: 120,278,181	F1017L	probably damaging	Het
Abcb11	A	C	2: 69,245,923	V1147G	probably damaging	Het
Abcc10	T	A	17: 46,306,603	S1128C	probably damaging	Het
Adam6a	G	A	12: 113,545,303	C432Y	probably damaging	Het
Adamdec1	C	T	14: 68,570,948	V318M	probably damaging	Het
Ahnak	C	A	19: 9,002,048	S232Y	possibly damaging	Het
Amt	A	C	9: 108,297,162	H42P	probably damaging	Het
Anapc1	A	T	2: 128,659,788	L778Q	probably damaging	Het
Ankhd1	G	A	18: 36,644,527	A1588T	probably benign	Het
Anln	A	T	9: 22,353,331	L881Q	probably damaging	Het
Appl1	A	G	14: 26,927,749	S607P	probably damaging	Het
Arg2	G	T	12: 79,147,662	V87L	probably benign	Het
Atp13a2	C	T	4: 141,004,012	P869L	probably benign	Het
Atxn7l1	T	A	12: 33,358,770	D310E	probably damaging	Het
Cd6	A	T	19: 10,798,602	D164E	probably damaging	Het
Cdan1	C	A	2: 120,724,936	V775L	probably benign	Het
Cep164	A	T	9: 45,775,758		probably null	Het
Cep41	A	G	6: 30,661,006	S61P	probably damaging	Het
Clcn7	C	A	17: 25,160,471	D764E	probably damaging	Het
Cog2	G	A	8: 124,551,403	G703S	possibly damaging	Het
Cramp1l	T	C	17: 24,968,978	D1214G	probably damaging	Het
Cst7	G	T	2: 150,577,708	C98F	probably damaging	Het
Ctc1	T	A	11: 69,034,658	L1007Q	probably damaging	Het
Cyb5r4	G	A	9: 87,022,209	A11T	possibly damaging	Het
Dcaf8	A	G	1: 172,175,553	D306G	probably damaging	Het
Defb38	T	A	8: 19,023,576	K27I	probably benign	Het
Disp3	T	C	4: 148,271,632	E257G	probably damaging	Het
Dnajc6	T	C	4: 101,598,988	S58P	probably damaging	Het
Dock10	A	T	1: 80,606,568	D140E	possibly damaging	Het
Dopey1	T	C	9: 86,492,004	V172A	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Eci3	C	T	13: 34,953,028	A171T	possibly damaging	Het
Eml2	A	G	7: 19,194,061	D284G	probably damaging	Het
Eml5	T	C	12: 98,810,584	D1377G	probably damaging	Het
Fam186a	T	C	15: 99,940,302	E2687G	possibly damaging	Het
Fut9	A	C	4: 25,620,352	L154R	probably damaging	Het
Gabrb2	A	G	11: 42,626,713	N454S	probably benign	Het
Gm438	T	A	4: 144,777,883	M233L	probably benign	Het
Gpr183	T	A	14: 121,954,741	I123L	probably benign	Het
Gucy1b1	A	T	3: 82,058,352	N62K	probably benign	Het
Hcrtr2	T	C	9: 76,259,785	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,794	L2556Q	probably damaging	Het
Hfm1	T	A	5: 106,847,676	M1290L	probably benign	Het
Hgsnat	A	G	8: 25,957,256	W337R	probably benign	Het
Hmbox1	T	C	14: 64,828,648	Y291C	probably damaging	Het
Hmcn1	T	C	1: 150,721,664	N1749S	probably benign	Het
Igsf10	T	C	3: 59,331,272	D496G	possibly damaging	Het
Iqch	C	T	9: 63,534,337		probably null	Het
Irf6	A	G	1: 193,167,535	D255G	probably benign	Het
Kif9	G	A	9: 110,517,719	G642R	probably null	Het
Klhl20	A	G	1: 161,106,742	Y236H	probably benign	Het
Krt39	T	A	11: 99,519,088	K208*	probably null	Het
Lama3	T	A	18: 12,537,781	L808*	probably null	Het
Lrp5	C	T	19: 3,597,346	A1299T	probably benign	Het
Lysmd4	A	G	7: 67,226,231	Q214R	probably benign	Het
Macf1	T	A	4: 123,369,848	E6960V	probably damaging	Het
Mcpt2	A	G	14: 56,043,699	E120G	probably benign	Het
Mpeg1	A	G	19: 12,462,356	T393A	probably benign	Het
Myh4	G	A	11: 67,255,682	E1494K	probably damaging	Het
Nbas	T	G	12: 13,474,229	S1695R	possibly damaging	Het
Nlgn1	G	T	3: 25,440,037	Y249*	probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nup107	A	G	10: 117,750,906	L910P	probably damaging	Het
Obscn	T	A	11: 59,040,296	D5838V	probably damaging	Het
Olfr1218	G	A	2: 89,054,859	T189M	possibly damaging	Het
Olfr347	T	C	2: 36,734,345	I8T	probably benign	Het
Olfr926	T	C	9: 38,877,596	I140T	possibly damaging	Het
Olfr978	T	C	9: 39,994,359	I183T	probably benign	Het
Otogl	G	T	10: 107,854,264	S915Y	possibly damaging	Het
P2rx7	T	A	5: 122,681,032	C506S	probably damaging	Het
P4hb	T	C	11: 120,563,218	E350G	probably benign	Het
Papolg	A	T	11: 23,867,379	V606E	probably benign	Het
Pappa	A	T	4: 65,340,743	D1576V	probably damaging	Het
Pclo	G	T	5: 14,778,552	V1402F	probably damaging	Het
Pdcd11	A	G	19: 47,098,187	T211A	probably benign	Het
Pdzd2	T	C	15: 12,373,855	R2065G	possibly damaging	Het
Plcl2	T	C	17: 50,607,850	V629A	probably benign	Het
Prkcsh	G	A	9: 22,004,575	V92I	possibly damaging	Het
Prpf19	G	T	19: 10,902,416	V320F	probably damaging	Het
Rcc2	T	A	4: 140,720,604	D480E	probably benign	Het
Rnf182	G	A	13: 43,668,042	C23Y	probably damaging	Het
Rnf186	C	T	4: 138,967,362	T71I	probably benign	Het
Scyl3	A	G	1: 163,933,696		probably null	Het
Slc12a6	G	T	2: 112,335,927		probably null	Het
Slc1a2	C	A	2: 102,777,567	S520Y	probably damaging	Het
Slc35e2	T	A	4: 155,611,729	L191Q	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx33	T	C	9: 56,926,011	H258R	possibly damaging	Het
Tecpr2	A	T	12: 110,933,064	H622L	probably benign	Het
Thbs3	A	T	3: 89,226,406	E888D	probably damaging	Het
Tlk2	T	C	11: 105,221,298	L159P	probably benign	Het
Tmem70	A	T	1: 16,677,273	T205S	probably damaging	Het
Trappc10	T	A	10: 78,196,451	H1001L	probably benign	Het
Trim12a	T	C	7: 104,300,857	T292A	probably benign	Het
Trip11	G	A	12: 101,883,333	R92*	probably null	Het
Trpa1	G	A	1: 14,899,388	Q386*	probably null	Het
Trpc4	T	A	3: 54,279,989	V454D	probably damaging	Het
Ttc36	A	T	9: 44,802,754	D22E	probably benign	Het
Ttk	A	T	9: 83,869,263	I798F	probably damaging	Het
Ttn	T	C	2: 76,743,633	I17312V	probably damaging	Het
Txndc15	A	T	13: 55,718,062	E113V	possibly damaging	Het
Ube2d4	T	A	15: 58,846,599		noncoding transcript	Het
Urb1	T	A	16: 90,761,695	T1723S	probably benign	Het
Vmn1r65	A	T	7: 6,008,266	V323D	possibly damaging	Het
Vmn2r54	A	G	7: 12,632,311	M232T	probably benign	Het
Wdr59	A	G	8: 111,476,181	S577P	probably damaging	Het
Wfikkn2	C	T	11: 94,238,123	W397*	probably null	Het
Ypel1	T	A	16: 17,081,647		probably null	Het
Ythdf1	T	A	2: 180,910,970	D484V	probably damaging	Het
Zdhhc17	A	G	10: 110,947,293		probably null	Het
Zfp472	A	T	17: 32,965,913	H2L	possibly damaging	Het
Zfp953	A	T	13: 67,345,358	M74K	probably benign	Het
Zmat4	C	T	8: 23,929,135	T61M	probably benign	Het

Other mutations in Ptpn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:Ptpn3	APN	4	57270050	missense	possibly damaging	0.95
IGL01090:Ptpn3	APN	4	57240833	missense	probably damaging	1.00
IGL01399:Ptpn3	APN	4	57225775	missense	probably benign	0.01
IGL01413:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01418:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01806:Ptpn3	APN	4	57254915	critical splice donor site	probably null
IGL01933:Ptpn3	APN	4	57197576	missense	probably benign	0.00
IGL02087:Ptpn3	APN	4	57222019	missense	probably damaging	1.00
IGL02269:Ptpn3	APN	4	57197510	missense	possibly damaging	0.72
IGL02413:Ptpn3	APN	4	57205020	missense	probably damaging	1.00
IGL03163:Ptpn3	APN	4	57222020	missense	probably damaging	1.00
R0179:Ptpn3	UTSW	4	57270118	missense	probably benign	0.00
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0310:Ptpn3	UTSW	4	57204958	missense	probably benign	0.00
R0492:Ptpn3	UTSW	4	57194304	missense	probably benign
R0631:Ptpn3	UTSW	4	57204921	missense	probably damaging	0.99
R0656:Ptpn3	UTSW	4	57270075	missense	probably benign	0.41
R1443:Ptpn3	UTSW	4	57225775	missense	probably benign	0.01
R1741:Ptpn3	UTSW	4	57254922	missense	probably damaging	1.00
R3753:Ptpn3	UTSW	4	57270144	missense	probably damaging	1.00
R4431:Ptpn3	UTSW	4	57235355	missense	probably damaging	0.97
R4704:Ptpn3	UTSW	4	57270119	missense	possibly damaging	0.79
R4935:Ptpn3	UTSW	4	57197568	missense	probably damaging	1.00
R5119:Ptpn3	UTSW	4	57218513	missense	possibly damaging	0.93
R5410:Ptpn3	UTSW	4	57205019	missense	probably damaging	1.00
R5554:Ptpn3	UTSW	4	57240843	missense	probably damaging	0.99
R6024:Ptpn3	UTSW	4	57248653	splice site	probably null
R6061:Ptpn3	UTSW	4	57248681	missense	probably damaging	1.00
R6212:Ptpn3	UTSW	4	57270070	missense	probably damaging	1.00
R6213:Ptpn3	UTSW	4	57265012	missense	probably damaging	1.00
R6239:Ptpn3	UTSW	4	57249981	missense	probably benign
R6444:Ptpn3	UTSW	4	57195730	missense	possibly damaging	0.51
R6606:Ptpn3	UTSW	4	57265104	splice site	probably null
R6656:Ptpn3	UTSW	4	57205905	missense	probably damaging	0.99
R6730:Ptpn3	UTSW	4	57270088	missense	probably benign
R7133:Ptpn3	UTSW	4	57225863	missense	probably benign	0.30
R7231:Ptpn3	UTSW	4	57245062	missense	probably damaging	1.00
R7237:Ptpn3	UTSW	4	57239625	missense	probably damaging	1.00
R7368:Ptpn3	UTSW	4	57221993	missense	probably damaging	1.00
R7604:Ptpn3	UTSW	4	57240845	missense	probably damaging	0.99
R7742:Ptpn3	UTSW	4	57265092	critical splice acceptor site	probably null
R8023:Ptpn3	UTSW	4	57248688	missense	probably benign	0.02
R8099:Ptpn3	UTSW	4	57204985	nonsense	probably null
R8155:Ptpn3	UTSW	4	57232336	missense	probably benign
R8302:Ptpn3	UTSW	4	57218514	missense	probably benign	0.01
R8315:Ptpn3	UTSW	4	57270063	missense	possibly damaging	0.88
R8335:Ptpn3	UTSW	4	57235286	missense	probably damaging	0.99
R8346:Ptpn3	UTSW	4	57225547	missense	probably damaging	0.99
R8348:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8448:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8513:Ptpn3	UTSW	4	57270085	nonsense	probably null
R8846:Ptpn3	UTSW	4	57205020	missense	probably damaging	1.00
R9244:Ptpn3	UTSW	4	57254915	critical splice donor site	probably null
R9337:Ptpn3	UTSW	4	57218521	missense	probably damaging	0.96
R9478:Ptpn3	UTSW	4	57197573	missense	probably damaging	1.00
R9500:Ptpn3	UTSW	4	57205914	missense	possibly damaging	0.83
R9710:Ptpn3	UTSW	4	57249957	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTCCCTGGAAGTAGACTCAC -3'
(R):5'- AGACATGGGTTCAGGCTATTTC -3'

Sequencing Primer
(F):5'- CCCTGGAAGTAGACTCACTTTTTGG -3'
(R):5'- CATGGAGGGTTCACAGCTCTG -3'

Posted On

2014-06-23