Mutagenetix > Incidental Mutation

Incidental Mutation 'R1856:Trappc10'

206139

Institutional Source

Beutler Lab

Gene Symbol

Trappc10

Ensembl Gene

ENSMUSG00000000374

Gene Name

trafficking protein particle complex 10

Synonyms

Tmem1, LOC380642, B230307C21Rik

MMRRC Submission

039880-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1856 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78186725-78244641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78196451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1001 (H1001L)

Ref Sequence

ENSEMBL: ENSMUSP00000000384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000384]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000000384
AA Change: H1001L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: H1001L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC10	1016	1245	1.1e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219948

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	G	7: 120,278,181	F1017L	probably damaging	Het
Abcb11	A	C	2: 69,245,923	V1147G	probably damaging	Het
Abcc10	T	A	17: 46,306,603	S1128C	probably damaging	Het
Adam6a	G	A	12: 113,545,303	C432Y	probably damaging	Het
Adamdec1	C	T	14: 68,570,948	V318M	probably damaging	Het
Ahnak	C	A	19: 9,002,048	S232Y	possibly damaging	Het
Amt	A	C	9: 108,297,162	H42P	probably damaging	Het
Anapc1	A	T	2: 128,659,788	L778Q	probably damaging	Het
Ankhd1	G	A	18: 36,644,527	A1588T	probably benign	Het
Anln	A	T	9: 22,353,331	L881Q	probably damaging	Het
Appl1	A	G	14: 26,927,749	S607P	probably damaging	Het
Arg2	G	T	12: 79,147,662	V87L	probably benign	Het
Atp13a2	C	T	4: 141,004,012	P869L	probably benign	Het
Atxn7l1	T	A	12: 33,358,770	D310E	probably damaging	Het
Cd6	A	T	19: 10,798,602	D164E	probably damaging	Het
Cdan1	C	A	2: 120,724,936	V775L	probably benign	Het
Cep164	A	T	9: 45,775,758		probably null	Het
Cep41	A	G	6: 30,661,006	S61P	probably damaging	Het
Clcn7	C	A	17: 25,160,471	D764E	probably damaging	Het
Cog2	G	A	8: 124,551,403	G703S	possibly damaging	Het
Cramp1l	T	C	17: 24,968,978	D1214G	probably damaging	Het
Cst7	G	T	2: 150,577,708	C98F	probably damaging	Het
Ctc1	T	A	11: 69,034,658	L1007Q	probably damaging	Het
Cyb5r4	G	A	9: 87,022,209	A11T	possibly damaging	Het
Dcaf8	A	G	1: 172,175,553	D306G	probably damaging	Het
Defb38	T	A	8: 19,023,576	K27I	probably benign	Het
Disp3	T	C	4: 148,271,632	E257G	probably damaging	Het
Dnajc6	T	C	4: 101,598,988	S58P	probably damaging	Het
Dock10	A	T	1: 80,606,568	D140E	possibly damaging	Het
Dopey1	T	C	9: 86,492,004	V172A	probably damaging	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Eci3	C	T	13: 34,953,028	A171T	possibly damaging	Het
Eml2	A	G	7: 19,194,061	D284G	probably damaging	Het
Eml5	T	C	12: 98,810,584	D1377G	probably damaging	Het
Fam186a	T	C	15: 99,940,302	E2687G	possibly damaging	Het
Fut9	A	C	4: 25,620,352	L154R	probably damaging	Het
Gabrb2	A	G	11: 42,626,713	N454S	probably benign	Het
Gm438	T	A	4: 144,777,883	M233L	probably benign	Het
Gpr183	T	A	14: 121,954,741	I123L	probably benign	Het
Gucy1b1	A	T	3: 82,058,352	N62K	probably benign	Het
Hcrtr2	T	C	9: 76,259,785	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,794	L2556Q	probably damaging	Het
Hfm1	T	A	5: 106,847,676	M1290L	probably benign	Het
Hgsnat	A	G	8: 25,957,256	W337R	probably benign	Het
Hmbox1	T	C	14: 64,828,648	Y291C	probably damaging	Het
Hmcn1	T	C	1: 150,721,664	N1749S	probably benign	Het
Igsf10	T	C	3: 59,331,272	D496G	possibly damaging	Het
Iqch	C	T	9: 63,534,337		probably null	Het
Irf6	A	G	1: 193,167,535	D255G	probably benign	Het
Kif9	G	A	9: 110,517,719	G642R	probably null	Het
Klhl20	A	G	1: 161,106,742	Y236H	probably benign	Het
Krt39	T	A	11: 99,519,088	K208*	probably null	Het
Lama3	T	A	18: 12,537,781	L808*	probably null	Het
Lrp5	C	T	19: 3,597,346	A1299T	probably benign	Het
Lysmd4	A	G	7: 67,226,231	Q214R	probably benign	Het
Macf1	T	A	4: 123,369,848	E6960V	probably damaging	Het
Mcpt2	A	G	14: 56,043,699	E120G	probably benign	Het
Mpeg1	A	G	19: 12,462,356	T393A	probably benign	Het
Myh4	G	A	11: 67,255,682	E1494K	probably damaging	Het
Nbas	T	G	12: 13,474,229	S1695R	possibly damaging	Het
Nlgn1	G	T	3: 25,440,037	Y249*	probably null	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nup107	A	G	10: 117,750,906	L910P	probably damaging	Het
Obscn	T	A	11: 59,040,296	D5838V	probably damaging	Het
Olfr1218	G	A	2: 89,054,859	T189M	possibly damaging	Het
Olfr347	T	C	2: 36,734,345	I8T	probably benign	Het
Olfr926	T	C	9: 38,877,596	I140T	possibly damaging	Het
Olfr978	T	C	9: 39,994,359	I183T	probably benign	Het
Otogl	G	T	10: 107,854,264	S915Y	possibly damaging	Het
P2rx7	T	A	5: 122,681,032	C506S	probably damaging	Het
P4hb	T	C	11: 120,563,218	E350G	probably benign	Het
Papolg	A	T	11: 23,867,379	V606E	probably benign	Het
Pappa	A	T	4: 65,340,743	D1576V	probably damaging	Het
Pclo	G	T	5: 14,778,552	V1402F	probably damaging	Het
Pdcd11	A	G	19: 47,098,187	T211A	probably benign	Het
Pdzd2	T	C	15: 12,373,855	R2065G	possibly damaging	Het
Plcl2	T	C	17: 50,607,850	V629A	probably benign	Het
Prkcsh	G	A	9: 22,004,575	V92I	possibly damaging	Het
Prpf19	G	T	19: 10,902,416	V320F	probably damaging	Het
Ptpn3	T	A	4: 57,239,682	I283F	probably damaging	Het
Rcc2	T	A	4: 140,720,604	D480E	probably benign	Het
Rnf182	G	A	13: 43,668,042	C23Y	probably damaging	Het
Rnf186	C	T	4: 138,967,362	T71I	probably benign	Het
Scyl3	A	G	1: 163,933,696		probably null	Het
Slc12a6	G	T	2: 112,335,927		probably null	Het
Slc1a2	C	A	2: 102,777,567	S520Y	probably damaging	Het
Slc35e2	T	A	4: 155,611,729	L191Q	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Snx33	T	C	9: 56,926,011	H258R	possibly damaging	Het
Tecpr2	A	T	12: 110,933,064	H622L	probably benign	Het
Thbs3	A	T	3: 89,226,406	E888D	probably damaging	Het
Tlk2	T	C	11: 105,221,298	L159P	probably benign	Het
Tmem70	A	T	1: 16,677,273	T205S	probably damaging	Het
Trim12a	T	C	7: 104,300,857	T292A	probably benign	Het
Trip11	G	A	12: 101,883,333	R92*	probably null	Het
Trpa1	G	A	1: 14,899,388	Q386*	probably null	Het
Trpc4	T	A	3: 54,279,989	V454D	probably damaging	Het
Ttc36	A	T	9: 44,802,754	D22E	probably benign	Het
Ttk	A	T	9: 83,869,263	I798F	probably damaging	Het
Ttn	T	C	2: 76,743,633	I17312V	probably damaging	Het
Txndc15	A	T	13: 55,718,062	E113V	possibly damaging	Het
Ube2d4	T	A	15: 58,846,599		noncoding transcript	Het
Urb1	T	A	16: 90,761,695	T1723S	probably benign	Het
Vmn1r65	A	T	7: 6,008,266	V323D	possibly damaging	Het
Vmn2r54	A	G	7: 12,632,311	M232T	probably benign	Het
Wdr59	A	G	8: 111,476,181	S577P	probably damaging	Het
Wfikkn2	C	T	11: 94,238,123	W397*	probably null	Het
Ypel1	T	A	16: 17,081,647		probably null	Het
Ythdf1	T	A	2: 180,910,970	D484V	probably damaging	Het
Zdhhc17	A	G	10: 110,947,293		probably null	Het
Zfp472	A	T	17: 32,965,913	H2L	possibly damaging	Het
Zfp953	A	T	13: 67,345,358	M74K	probably benign	Het
Zmat4	C	T	8: 23,929,135	T61M	probably benign	Het

Other mutations in Trappc10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Trappc10	APN	10	78203877	splice site	probably benign
IGL01375:Trappc10	APN	10	78188899	missense	possibly damaging	0.75
IGL01413:Trappc10	APN	10	78197844	missense	possibly damaging	0.87
IGL02413:Trappc10	APN	10	78210776	missense	probably damaging	0.99
IGL03037:Trappc10	APN	10	78199035	unclassified	probably benign
IGL03094:Trappc10	APN	10	78228920	splice site	probably benign
IGL03164:Trappc10	APN	10	78220242	missense	probably damaging	1.00
IGL03351:Trappc10	APN	10	78188761	missense	probably damaging	1.00
IGL03055:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
IGL03098:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
R0304:Trappc10	UTSW	10	78210760	splice site	probably benign
R0605:Trappc10	UTSW	10	78201497	missense	possibly damaging	0.70
R1806:Trappc10	UTSW	10	78210776	missense	probably damaging	0.99
R2045:Trappc10	UTSW	10	78209479	splice site	probably benign
R2088:Trappc10	UTSW	10	78196334	missense	probably benign	0.00
R2126:Trappc10	UTSW	10	78203924	missense	possibly damaging	0.94
R2202:Trappc10	UTSW	10	78199042	critical splice donor site	probably null
R2509:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2510:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2511:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2893:Trappc10	UTSW	10	78193401	missense	probably benign	0.00
R3744:Trappc10	UTSW	10	78199090	missense	probably benign	0.00
R3778:Trappc10	UTSW	10	78200802	missense	possibly damaging	0.89
R3876:Trappc10	UTSW	10	78220186	splice site	probably null
R3930:Trappc10	UTSW	10	78210403	missense	probably benign	0.03
R4078:Trappc10	UTSW	10	78210382	missense	probably damaging	1.00
R4111:Trappc10	UTSW	10	78196430	missense	probably benign	0.09
R4418:Trappc10	UTSW	10	78217188	missense	probably damaging	1.00
R4549:Trappc10	UTSW	10	78231458	missense	probably damaging	1.00
R4695:Trappc10	UTSW	10	78197863	missense	probably damaging	0.99
R4799:Trappc10	UTSW	10	78201590	missense	possibly damaging	0.71
R5022:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5023:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5026:Trappc10	UTSW	10	78204288	missense	possibly damaging	0.82
R5057:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5282:Trappc10	UTSW	10	78187860	missense	probably damaging	1.00
R5363:Trappc10	UTSW	10	78188840	missense	possibly damaging	0.92
R5813:Trappc10	UTSW	10	78222739	missense	probably damaging	1.00
R5831:Trappc10	UTSW	10	78209426	missense	probably damaging	1.00
R6209:Trappc10	UTSW	10	78214812	missense	possibly damaging	0.50
R6450:Trappc10	UTSW	10	78209450	missense	possibly damaging	0.92
R6520:Trappc10	UTSW	10	78201453	missense	probably benign	0.00
R6533:Trappc10	UTSW	10	78188894	missense	probably damaging	0.96
R6767:Trappc10	UTSW	10	78193511	missense	possibly damaging	0.75
R6798:Trappc10	UTSW	10	78188831	missense	probably benign	0.00
R7205:Trappc10	UTSW	10	78210428	missense	probably damaging	1.00
R7282:Trappc10	UTSW	10	78207493	missense	probably damaging	0.98
R7378:Trappc10	UTSW	10	78193418	missense	probably damaging	0.96
R7384:Trappc10	UTSW	10	78209384	missense	possibly damaging	0.85
R7770:Trappc10	UTSW	10	78210845	missense	probably damaging	0.96
R7829:Trappc10	UTSW	10	78199075	missense	probably benign
R7839:Trappc10	UTSW	10	78188812	missense	possibly damaging	0.84
R8298:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R8306:Trappc10	UTSW	10	78200626	missense	possibly damaging	0.54
R8814:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R9035:Trappc10	UTSW	10	78207889	unclassified	probably benign
R9075:Trappc10	UTSW	10	78204296	missense	possibly damaging	0.77
R9112:Trappc10	UTSW	10	78193367	missense	probably damaging	0.99
R9182:Trappc10	UTSW	10	78214630	missense	probably damaging	1.00
R9444:Trappc10	UTSW	10	78197778	missense	probably benign	0.10
R9801:Trappc10	UTSW	10	78209429	missense	probably benign	0.00
Z1177:Trappc10	UTSW	10	78217153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGTGCTTTGTGCTTCCATCC -3'
(R):5'- AGACTCCTTTTACCAGCTGGG -3'

Sequencing Primer
(F):5'- GTGCTTTGTGCTTCCATCCCATAC -3'
(R):5'- GGGGCTCAGGTCTGTGC -3'

Posted On

2014-06-23