Incidental Mutation 'R1856:Appl1'
ID206167
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
MMRRC Submission 039880-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26927749 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 607 (S607P)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect probably damaging
Transcript: ENSMUST00000036570
AA Change: S607P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: S607P

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223843
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATTCAAGACTGAACCAGCTATC -3'
(R):5'- ATCCCTAGAGAGTTTATGCACC -3'

Sequencing Primer
(F):5'- GAACCTGACAGGCTGCAC -3'
(R):5'- TCCCTAGAGAGTTTATGCACCAAAGG -3'
Posted On2014-06-23