Incidental Mutation 'R1856:Hmbox1'
ID206170
Institutional Source Beutler Lab
Gene Symbol Hmbox1
Ensembl Gene ENSMUSG00000021972
Gene Namehomeobox containing 1
SynonymsF830020C16Rik
MMRRC Submission 039880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location64811600-64949871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64828648 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 291 (Y291C)
Ref Sequence ENSEMBL: ENSMUSP00000135211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022544] [ENSMUST00000067843] [ENSMUST00000175744] [ENSMUST00000175905] [ENSMUST00000176128] [ENSMUST00000176489] [ENSMUST00000176832]
Predicted Effect probably damaging
Transcript: ENSMUST00000022544
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022544
Gene: ENSMUSG00000021972
AA Change: Y291C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 2.3e-15 PFAM
HOX 267 344 6.18e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067843
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066905
Gene: ENSMUSG00000021972
AA Change: Y291C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 2.5e-15 PFAM
HOX 267 344 8.74e-9 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175744
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135272
Gene: ENSMUSG00000021972
AA Change: Y291C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.4e-15 PFAM
HOX 267 344 8.74e-9 SMART
low complexity region 382 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175905
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135657
Gene: ENSMUSG00000021972
AA Change: Y291C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.5e-15 PFAM
HOX 267 344 6.18e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176128
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135448
Gene: ENSMUSG00000021972
AA Change: Y291C

DomainStartEndE-ValueType
Pfam:HNF-1_N 25 227 4.4e-66 PFAM
HOX 267 344 6.18e-9 SMART
low complexity region 373 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176489
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134824
Gene: ENSMUSG00000021972
AA Change: Y291C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.1e-15 PFAM
HOX 267 355 1.89e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176832
AA Change: Y291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135211
Gene: ENSMUSG00000021972
AA Change: Y291C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.4e-15 PFAM
HOX 267 344 8.74e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177326
AA Change: Y292C
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit absence of TERT binding to chromatin as shown by subcellular fractionation analysis of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Hmbox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03183:Hmbox1 APN 14 64887599 missense probably damaging 1.00
R0962:Hmbox1 UTSW 14 64896774 missense probably benign 0.00
R1144:Hmbox1 UTSW 14 64825683 missense probably damaging 1.00
R1467:Hmbox1 UTSW 14 64861578 missense possibly damaging 0.90
R1467:Hmbox1 UTSW 14 64861578 missense possibly damaging 0.90
R2101:Hmbox1 UTSW 14 64828579 splice site probably benign
R3707:Hmbox1 UTSW 14 64896836 missense probably benign 0.02
R4531:Hmbox1 UTSW 14 64825489 missense probably benign
R4570:Hmbox1 UTSW 14 64823662 missense possibly damaging 0.95
R4572:Hmbox1 UTSW 14 64903233 splice site probably null
R4740:Hmbox1 UTSW 14 64897034 missense probably damaging 1.00
R4807:Hmbox1 UTSW 14 64825549 intron probably benign
R5112:Hmbox1 UTSW 14 64825612 missense probably damaging 1.00
R5327:Hmbox1 UTSW 14 64896695 missense possibly damaging 0.77
R5575:Hmbox1 UTSW 14 64823164 missense probably benign
R5928:Hmbox1 UTSW 14 64823673 missense possibly damaging 0.55
R6934:Hmbox1 UTSW 14 64896832 missense probably benign 0.33
R7155:Hmbox1 UTSW 14 64897037 missense probably damaging 1.00
R7302:Hmbox1 UTSW 14 64828666 missense probably damaging 1.00
R7499:Hmbox1 UTSW 14 64896677 missense possibly damaging 0.76
R8361:Hmbox1 UTSW 14 64896840 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCACTTGACTCATGCCATGG -3'
(R):5'- TGGAGCCACCAGTCACAATTAG -3'

Sequencing Primer
(F):5'- AGCTCATACCTTACCTGG -3'
(R):5'- AGCTTCCTCTCAAGTACAAGTGGG -3'
Posted On2014-06-23