Incidental Mutation 'R1856:Urb1'
ID 206179
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene Name URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms 5730405K23Rik, 4921511H13Rik
MMRRC Submission 039880-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1856 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 90548415-90607301 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90558583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1723 (T1723S)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000140920
AA Change: T1723S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: T1723S

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,504,453 (GRCm39) M233L probably benign Het
Abca14 T G 7: 119,877,404 (GRCm39) F1017L probably damaging Het
Abcb11 A C 2: 69,076,267 (GRCm39) V1147G probably damaging Het
Abcc10 T A 17: 46,617,529 (GRCm39) S1128C probably damaging Het
Adam6a G A 12: 113,508,923 (GRCm39) C432Y probably damaging Het
Adamdec1 C T 14: 68,808,397 (GRCm39) V318M probably damaging Het
Ahnak C A 19: 8,979,412 (GRCm39) S232Y possibly damaging Het
Amt A C 9: 108,174,361 (GRCm39) H42P probably damaging Het
Anapc1 A T 2: 128,501,708 (GRCm39) L778Q probably damaging Het
Ankhd1 G A 18: 36,777,580 (GRCm39) A1588T probably benign Het
Anln A T 9: 22,264,627 (GRCm39) L881Q probably damaging Het
Appl1 A G 14: 26,649,706 (GRCm39) S607P probably damaging Het
Arg2 G T 12: 79,194,436 (GRCm39) V87L probably benign Het
Atp13a2 C T 4: 140,731,323 (GRCm39) P869L probably benign Het
Atxn7l1 T A 12: 33,408,769 (GRCm39) D310E probably damaging Het
Cd6 A T 19: 10,775,966 (GRCm39) D164E probably damaging Het
Cdan1 C A 2: 120,555,417 (GRCm39) V775L probably benign Het
Cep164 A T 9: 45,687,056 (GRCm39) probably null Het
Cep41 A G 6: 30,661,005 (GRCm39) S61P probably damaging Het
Clcn7 C A 17: 25,379,445 (GRCm39) D764E probably damaging Het
Cog2 G A 8: 125,278,142 (GRCm39) G703S possibly damaging Het
Cramp1 T C 17: 25,187,952 (GRCm39) D1214G probably damaging Het
Cst7 G T 2: 150,419,628 (GRCm39) C98F probably damaging Het
Ctc1 T A 11: 68,925,484 (GRCm39) L1007Q probably damaging Het
Cyb5r4 G A 9: 86,904,262 (GRCm39) A11T possibly damaging Het
Dcaf8 A G 1: 172,003,120 (GRCm39) D306G probably damaging Het
Defb38 T A 8: 19,073,592 (GRCm39) K27I probably benign Het
Disp3 T C 4: 148,356,089 (GRCm39) E257G probably damaging Het
Dnajc6 T C 4: 101,456,185 (GRCm39) S58P probably damaging Het
Dock10 A T 1: 80,584,285 (GRCm39) D140E possibly damaging Het
Dop1a T C 9: 86,374,057 (GRCm39) V172A probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Eci3 C T 13: 35,137,011 (GRCm39) A171T possibly damaging Het
Eml2 A G 7: 18,927,986 (GRCm39) D284G probably damaging Het
Eml5 T C 12: 98,776,843 (GRCm39) D1377G probably damaging Het
Fam186a T C 15: 99,838,183 (GRCm39) E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 (GRCm39) L154R probably damaging Het
Gabrb2 A G 11: 42,517,540 (GRCm39) N454S probably benign Het
Gpr183 T A 14: 122,192,153 (GRCm39) I123L probably benign Het
Gucy1b1 A T 3: 81,965,659 (GRCm39) N62K probably benign Het
Hcrtr2 T C 9: 76,167,067 (GRCm39) N90S probably damaging Het
Hectd1 A T 12: 51,791,577 (GRCm39) L2556Q probably damaging Het
Hfm1 T A 5: 106,995,542 (GRCm39) M1290L probably benign Het
Hgsnat A G 8: 26,447,284 (GRCm39) W337R probably benign Het
Hmbox1 T C 14: 65,066,097 (GRCm39) Y291C probably damaging Het
Hmcn1 T C 1: 150,597,415 (GRCm39) N1749S probably benign Het
Igsf10 T C 3: 59,238,693 (GRCm39) D496G possibly damaging Het
Iqch C T 9: 63,441,619 (GRCm39) probably null Het
Irf6 A G 1: 192,849,843 (GRCm39) D255G probably benign Het
Kif9 G A 9: 110,346,787 (GRCm39) G642R probably null Het
Klhl20 A G 1: 160,934,312 (GRCm39) Y236H probably benign Het
Krt39 T A 11: 99,409,914 (GRCm39) K208* probably null Het
Lama3 T A 18: 12,670,838 (GRCm39) L808* probably null Het
Lrp5 C T 19: 3,647,346 (GRCm39) A1299T probably benign Het
Lysmd4 A G 7: 66,875,979 (GRCm39) Q214R probably benign Het
Macf1 T A 4: 123,263,641 (GRCm39) E6960V probably damaging Het
Mcpt2 A G 14: 56,281,156 (GRCm39) E120G probably benign Het
Mpeg1 A G 19: 12,439,720 (GRCm39) T393A probably benign Het
Myh4 G A 11: 67,146,508 (GRCm39) E1494K probably damaging Het
Nbas T G 12: 13,524,230 (GRCm39) S1695R possibly damaging Het
Nlgn1 G T 3: 25,494,201 (GRCm39) Y249* probably null Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nup107 A G 10: 117,586,811 (GRCm39) L910P probably damaging Het
Obscn T A 11: 58,931,122 (GRCm39) D5838V probably damaging Het
Or10g7 T C 9: 39,905,655 (GRCm39) I183T probably benign Het
Or1j18 T C 2: 36,624,357 (GRCm39) I8T probably benign Het
Or4c113 G A 2: 88,885,203 (GRCm39) T189M possibly damaging Het
Or8d2b T C 9: 38,788,892 (GRCm39) I140T possibly damaging Het
Otogl G T 10: 107,690,125 (GRCm39) S915Y possibly damaging Het
P2rx7 T A 5: 122,819,095 (GRCm39) C506S probably damaging Het
P4hb T C 11: 120,454,044 (GRCm39) E350G probably benign Het
Papolg A T 11: 23,817,379 (GRCm39) V606E probably benign Het
Pappa A T 4: 65,258,980 (GRCm39) D1576V probably damaging Het
Pclo G T 5: 14,828,566 (GRCm39) V1402F probably damaging Het
Pdcd11 A G 19: 47,086,626 (GRCm39) T211A probably benign Het
Pdzd2 T C 15: 12,373,941 (GRCm39) R2065G possibly damaging Het
Plcl2 T C 17: 50,914,878 (GRCm39) V629A probably benign Het
Prkcsh G A 9: 21,915,871 (GRCm39) V92I possibly damaging Het
Prpf19 G T 19: 10,879,780 (GRCm39) V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 (GRCm39) I283F probably damaging Het
Rcc2 T A 4: 140,447,915 (GRCm39) D480E probably benign Het
Rnf182 G A 13: 43,821,518 (GRCm39) C23Y probably damaging Het
Rnf186 C T 4: 138,694,673 (GRCm39) T71I probably benign Het
Scyl3 A G 1: 163,761,265 (GRCm39) probably null Het
Slc12a6 G T 2: 112,166,272 (GRCm39) probably null Het
Slc1a2 C A 2: 102,607,912 (GRCm39) S520Y probably damaging Het
Slc35e2 T A 4: 155,696,186 (GRCm39) L191Q probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Snx33 T C 9: 56,833,295 (GRCm39) H258R possibly damaging Het
Tecpr2 A T 12: 110,899,498 (GRCm39) H622L probably benign Het
Thbs3 A T 3: 89,133,713 (GRCm39) E888D probably damaging Het
Tlk2 T C 11: 105,112,124 (GRCm39) L159P probably benign Het
Tmem70 A T 1: 16,747,497 (GRCm39) T205S probably damaging Het
Trappc10 T A 10: 78,032,285 (GRCm39) H1001L probably benign Het
Trim12a T C 7: 103,950,064 (GRCm39) T292A probably benign Het
Trip11 G A 12: 101,849,592 (GRCm39) R92* probably null Het
Trpa1 G A 1: 14,969,612 (GRCm39) Q386* probably null Het
Trpc4 T A 3: 54,187,410 (GRCm39) V454D probably damaging Het
Ttc36 A T 9: 44,714,051 (GRCm39) D22E probably benign Het
Ttk A T 9: 83,751,316 (GRCm39) I798F probably damaging Het
Ttn T C 2: 76,573,977 (GRCm39) I17312V probably damaging Het
Txndc15 A T 13: 55,865,875 (GRCm39) E113V possibly damaging Het
Ube2d4 T A 15: 58,718,448 (GRCm39) noncoding transcript Het
Vmn1r65 A T 7: 6,011,265 (GRCm39) V323D possibly damaging Het
Vmn2r54 A G 7: 12,366,238 (GRCm39) M232T probably benign Het
Wdr59 A G 8: 112,202,813 (GRCm39) S577P probably damaging Het
Wfikkn2 C T 11: 94,128,949 (GRCm39) W397* probably null Het
Ypel1 T A 16: 16,899,511 (GRCm39) probably null Het
Ythdf1 T A 2: 180,552,763 (GRCm39) D484V probably damaging Het
Zdhhc17 A G 10: 110,783,154 (GRCm39) probably null Het
Zfp472 A T 17: 33,184,887 (GRCm39) H2L possibly damaging Het
Zfp953 A T 13: 67,493,422 (GRCm39) M74K probably benign Het
Zmat4 C T 8: 24,419,151 (GRCm39) T61M probably benign Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90,550,209 (GRCm39) critical splice donor site probably null
IGL00915:Urb1 APN 16 90,575,986 (GRCm39) missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90,589,702 (GRCm39) missense probably damaging 1.00
IGL01122:Urb1 APN 16 90,601,346 (GRCm39) missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90,554,649 (GRCm39) missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90,574,448 (GRCm39) missense probably benign 0.11
IGL01606:Urb1 APN 16 90,557,347 (GRCm39) missense probably damaging 1.00
IGL01989:Urb1 APN 16 90,566,474 (GRCm39) splice site probably benign
IGL02516:Urb1 APN 16 90,569,583 (GRCm39) missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90,585,044 (GRCm39) missense probably benign 0.02
IGL03165:Urb1 APN 16 90,577,192 (GRCm39) missense probably damaging 1.00
IGL03216:Urb1 APN 16 90,585,002 (GRCm39) missense probably benign 0.00
H8562:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
H8786:Urb1 UTSW 16 90,566,357 (GRCm39) missense probably benign 0.08
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0064:Urb1 UTSW 16 90,576,028 (GRCm39) missense probably benign
R0359:Urb1 UTSW 16 90,588,048 (GRCm39) missense probably damaging 1.00
R0386:Urb1 UTSW 16 90,593,287 (GRCm39) missense probably damaging 1.00
R0508:Urb1 UTSW 16 90,580,150 (GRCm39) splice site probably benign
R0517:Urb1 UTSW 16 90,574,310 (GRCm39) nonsense probably null
R0704:Urb1 UTSW 16 90,573,095 (GRCm39) missense probably benign 0.31
R0755:Urb1 UTSW 16 90,576,026 (GRCm39) missense probably benign
R0755:Urb1 UTSW 16 90,570,982 (GRCm39) missense probably damaging 1.00
R0783:Urb1 UTSW 16 90,607,185 (GRCm39) missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90,592,336 (GRCm39) missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90,566,335 (GRCm39) missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90,573,206 (GRCm39) splice site probably null
R1344:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1418:Urb1 UTSW 16 90,566,354 (GRCm39) missense probably damaging 1.00
R1453:Urb1 UTSW 16 90,593,380 (GRCm39) missense probably damaging 1.00
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1470:Urb1 UTSW 16 90,548,902 (GRCm39) missense probably benign 0.34
R1520:Urb1 UTSW 16 90,571,633 (GRCm39) missense probably benign 0.00
R1521:Urb1 UTSW 16 90,550,751 (GRCm39) missense probably damaging 1.00
R1598:Urb1 UTSW 16 90,574,328 (GRCm39) missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90,557,340 (GRCm39) missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90,570,936 (GRCm39) critical splice donor site probably null
R1640:Urb1 UTSW 16 90,569,514 (GRCm39) missense probably benign 0.00
R1664:Urb1 UTSW 16 90,584,970 (GRCm39) critical splice donor site probably null
R1672:Urb1 UTSW 16 90,584,285 (GRCm39) missense probably damaging 1.00
R1694:Urb1 UTSW 16 90,563,928 (GRCm39) missense probably benign
R2001:Urb1 UTSW 16 90,559,232 (GRCm39) missense probably benign 0.30
R2196:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R2850:Urb1 UTSW 16 90,571,144 (GRCm39) missense probably benign 0.01
R3009:Urb1 UTSW 16 90,571,686 (GRCm39) missense probably benign 0.09
R3104:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3105:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3106:Urb1 UTSW 16 90,592,331 (GRCm39) missense probably damaging 1.00
R3160:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3162:Urb1 UTSW 16 90,594,791 (GRCm39) missense probably damaging 1.00
R3900:Urb1 UTSW 16 90,580,264 (GRCm39) missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90,566,353 (GRCm39) missense probably damaging 1.00
R4036:Urb1 UTSW 16 90,584,974 (GRCm39) missense probably benign
R4332:Urb1 UTSW 16 90,571,425 (GRCm39) missense probably damaging 1.00
R4448:Urb1 UTSW 16 90,566,282 (GRCm39) missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90,585,034 (GRCm39) missense probably benign 0.04
R4593:Urb1 UTSW 16 90,584,332 (GRCm39) missense probably damaging 1.00
R4610:Urb1 UTSW 16 90,573,159 (GRCm39) missense probably benign 0.43
R4659:Urb1 UTSW 16 90,573,017 (GRCm39) missense probably damaging 0.96
R4672:Urb1 UTSW 16 90,569,522 (GRCm39) missense probably benign
R4681:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R4771:Urb1 UTSW 16 90,550,406 (GRCm39) missense probably benign 0.00
R4790:Urb1 UTSW 16 90,566,443 (GRCm39) nonsense probably null
R4798:Urb1 UTSW 16 90,554,715 (GRCm39) missense probably benign 0.12
R4809:Urb1 UTSW 16 90,556,730 (GRCm39) missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90,592,302 (GRCm39) nonsense probably null
R4916:Urb1 UTSW 16 90,580,216 (GRCm39) missense probably damaging 1.00
R4969:Urb1 UTSW 16 90,602,299 (GRCm39) missense probably damaging 1.00
R5032:Urb1 UTSW 16 90,553,059 (GRCm39) missense probably benign 0.00
R5111:Urb1 UTSW 16 90,548,905 (GRCm39) missense probably benign 0.00
R5122:Urb1 UTSW 16 90,548,983 (GRCm39) nonsense probably null
R5184:Urb1 UTSW 16 90,580,162 (GRCm39) critical splice donor site probably null
R5199:Urb1 UTSW 16 90,589,636 (GRCm39) missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90,589,650 (GRCm39) missense probably damaging 1.00
R5767:Urb1 UTSW 16 90,573,051 (GRCm39) missense probably benign 0.00
R5812:Urb1 UTSW 16 90,601,425 (GRCm39) missense probably damaging 0.99
R5872:Urb1 UTSW 16 90,569,652 (GRCm39) nonsense probably null
R6052:Urb1 UTSW 16 90,559,271 (GRCm39) missense probably damaging 1.00
R6063:Urb1 UTSW 16 90,585,985 (GRCm39) missense probably benign 0.02
R6065:Urb1 UTSW 16 90,600,220 (GRCm39) missense probably benign 0.03
R6181:Urb1 UTSW 16 90,575,982 (GRCm39) missense probably benign 0.00
R6268:Urb1 UTSW 16 90,550,807 (GRCm39) missense probably benign 0.03
R6429:Urb1 UTSW 16 90,559,318 (GRCm39) splice site probably null
R6572:Urb1 UTSW 16 90,584,302 (GRCm39) missense probably benign 0.37
R6606:Urb1 UTSW 16 90,607,156 (GRCm39) missense probably benign 0.00
R6730:Urb1 UTSW 16 90,575,971 (GRCm39) missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90,578,994 (GRCm39) missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90,588,054 (GRCm39) missense probably damaging 1.00
R7238:Urb1 UTSW 16 90,549,003 (GRCm39) missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7341:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7361:Urb1 UTSW 16 90,571,656 (GRCm39) missense probably damaging 0.99
R7365:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7366:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7440:Urb1 UTSW 16 90,584,296 (GRCm39) missense probably damaging 1.00
R7530:Urb1 UTSW 16 90,558,522 (GRCm39) missense probably damaging 1.00
R7553:Urb1 UTSW 16 90,589,752 (GRCm39) missense probably damaging 1.00
R7557:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7603:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7607:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7609:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7610:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7612:Urb1 UTSW 16 90,594,798 (GRCm39) missense probably damaging 1.00
R7613:Urb1 UTSW 16 90,569,461 (GRCm39) critical splice donor site probably benign
R7684:Urb1 UTSW 16 90,583,006 (GRCm39) nonsense probably null
R8029:Urb1 UTSW 16 90,576,040 (GRCm39) missense possibly damaging 0.67
R8324:Urb1 UTSW 16 90,588,078 (GRCm39) missense probably damaging 1.00
R8680:Urb1 UTSW 16 90,571,513 (GRCm39) missense probably benign 0.00
R8785:Urb1 UTSW 16 90,600,311 (GRCm39) missense probably benign 0.07
R8914:Urb1 UTSW 16 90,607,122 (GRCm39) missense probably damaging 1.00
R8959:Urb1 UTSW 16 90,571,005 (GRCm39) missense probably benign 0.26
R9005:Urb1 UTSW 16 90,550,678 (GRCm39) missense probably benign 0.01
R9126:Urb1 UTSW 16 90,566,290 (GRCm39) missense possibly damaging 0.53
R9195:Urb1 UTSW 16 90,589,638 (GRCm39) missense probably benign 0.03
R9276:Urb1 UTSW 16 90,569,463 (GRCm39) splice site probably benign
R9534:Urb1 UTSW 16 90,583,096 (GRCm39) missense possibly damaging 0.54
Z1177:Urb1 UTSW 16 90,571,750 (GRCm39) missense probably benign 0.05
Z1177:Urb1 UTSW 16 90,550,771 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATGCCTCTCACAGCAATC -3'
(R):5'- GCCTGCTCCTAAAAGAAAAGG -3'

Sequencing Primer
(F):5'- CAGCAATCCCAGAGGCAGG -3'
(R):5'- CTCCAACAGGAAAGTACATAGT -3'
Posted On 2014-06-23