Incidental Mutation 'R1856:Clcn7'
ID 206181
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Name chloride channel, voltage-sensitive 7
Synonyms ClC-7
MMRRC Submission 039880-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1856 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25133391-25162104 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25160471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 764 (D764E)
Ref Sequence ENSEMBL: ENSMUSP00000124194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000073277] [ENSMUST00000160961] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178]
AlphaFold O70496
Predicted Effect probably damaging
Transcript: ENSMUST00000040729
AA Change: D784E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: D784E

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073277
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159426
Predicted Effect probably damaging
Transcript: ENSMUST00000160961
AA Change: D764E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: D764E

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162862
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182292
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182621
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25151123 missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25151116 missense probably benign 0.13
IGL01912:Clcn7 APN 17 25153009 splice site probably benign
IGL01936:Clcn7 APN 17 25155376 missense probably benign 0.44
IGL02084:Clcn7 APN 17 25157925 missense probably benign
IGL02121:Clcn7 APN 17 25153084 missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25149030 unclassified probably benign
IGL02335:Clcn7 APN 17 25146847 missense probably benign 0.00
IGL02507:Clcn7 APN 17 25144469 missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25146818 missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25146453 unclassified probably benign
IGL03192:Clcn7 APN 17 25133601 missense probably benign 0.00
IGL03194:Clcn7 APN 17 25150548 missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25155385 missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25153754 missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25149202 unclassified probably benign
R0970:Clcn7 UTSW 17 25151234 critical splice donor site probably null
R1644:Clcn7 UTSW 17 25159698 missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25144451 missense probably benign
R2173:Clcn7 UTSW 17 25145609 missense probably benign
R2401:Clcn7 UTSW 17 25153140 missense probably benign 0.02
R2511:Clcn7 UTSW 17 25155446 missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25159707 missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25160176 missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25157961 missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25153565 intron probably benign
R5372:Clcn7 UTSW 17 25157179 missense possibly damaging 0.82
R5820:Clcn7 UTSW 17 25149052 missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25157954 missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25151728 missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25157528 missense probably benign 0.01
R6798:Clcn7 UTSW 17 25159760 missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25157214 missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25146351 missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25153693 missense
R7757:Clcn7 UTSW 17 25156822 missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25149259 nonsense probably null
R8670:Clcn7 UTSW 17 25159614 missense probably damaging 0.99
R9031:Clcn7 UTSW 17 25157523 missense probably damaging 0.96
R9720:Clcn7 UTSW 17 25155497 missense probably damaging 1.00
X0020:Clcn7 UTSW 17 25150226 missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25153015 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCTTGTCTGTCTCAGGAC -3'
(R):5'- TGATGACTGAAACCAACTGCCC -3'

Sequencing Primer
(F):5'- TGTCTCAGGACAGTAAGCCTG -3'
(R):5'- CCTAGGGAGGGCATTTGC -3'
Posted On 2014-06-23