Incidental Mutation 'R1857:Sars2'
ID206226
Institutional Source Beutler Lab
Gene Symbol Sars2
Ensembl Gene ENSMUSG00000070699
Gene Nameseryl-aminoacyl-tRNA synthetase 2
Synonyms2410015F05Rik, D7Ertd353e
MMRRC Submission 039881-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28741992-28753871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28750012 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 322 (M322V)
Ref Sequence ENSEMBL: ENSMUSP00000092216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094632] [ENSMUST00000207877]
Predicted Effect probably benign
Transcript: ENSMUST00000094632
AA Change: M322V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699
AA Change: M322V

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207897
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cfap69 G T 5: 5,582,518 T362K possibly damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp2j5 T C 4: 96,659,486 E173G possibly damaging Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Eif4g3 A T 4: 138,175,876 Q1169L possibly damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Neurl4 G T 11: 69,905,535 G435V probably damaging Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Trove2 T C 1: 143,770,750 T86A probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Sars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Sars2 APN 7 28753423 unclassified probably benign
IGL01376:Sars2 APN 7 28749883 missense probably damaging 1.00
IGL01633:Sars2 APN 7 28747549 missense probably benign 0.02
IGL02121:Sars2 APN 7 28752525 unclassified probably benign
IGL02488:Sars2 APN 7 28742160 nonsense probably null
IGL03062:Sars2 APN 7 28746781 missense possibly damaging 0.89
R1601:Sars2 UTSW 7 28748971 missense probably benign 0.26
R1859:Sars2 UTSW 7 28744312 missense probably damaging 0.99
R2193:Sars2 UTSW 7 28748997 missense probably damaging 0.96
R2204:Sars2 UTSW 7 28749674 missense possibly damaging 0.95
R4452:Sars2 UTSW 7 28750093 missense probably benign 0.08
R4514:Sars2 UTSW 7 28742284 critical splice donor site probably null
R4921:Sars2 UTSW 7 28752438 missense possibly damaging 0.81
R5121:Sars2 UTSW 7 28747908 missense probably damaging 0.99
R5434:Sars2 UTSW 7 28750291 missense probably null 1.00
R5849:Sars2 UTSW 7 28744258 missense possibly damaging 0.92
R6668:Sars2 UTSW 7 28747004 missense probably benign 0.01
R7123:Sars2 UTSW 7 28753441 missense probably benign 0.40
R7205:Sars2 UTSW 7 28744308 missense probably benign
R7677:Sars2 UTSW 7 28746751 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTCCTGTGGGTAATGGCAG -3'
(R):5'- ACTCATCCAACAGCTGCGAG -3'

Sequencing Primer
(F):5'- TGGGTAATGGCAGCCCTG -3'
(R):5'- GGGCCTGTCACCCCAAAC -3'
Posted On2014-06-23