Incidental Mutation 'R0114:Gabpb1'
ID20624
Institutional Source Beutler Lab
Gene Symbol Gabpb1
Ensembl Gene ENSMUSG00000027361
Gene NameGA repeat binding protein, beta 1
SynonymsGABPB1-1, E4TF1-47, GABPB1-2, E4Tf1B, BABPB2, NRF2B2, E4TF1, E4TF1-53, NRF2B1
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0114 (G1)
Quality Score119
Status Validated (trace)
Chromosome2
Chromosomal Location126627442-126676337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126653574 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 86 (I86T)
Ref Sequence ENSEMBL: ENSMUSP00000106054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039978] [ENSMUST00000089745] [ENSMUST00000103226] [ENSMUST00000103227] [ENSMUST00000110424] [ENSMUST00000110425] [ENSMUST00000124972] [ENSMUST00000137335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039978
AA Change: I86T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037673
Gene: ENSMUSG00000027361
AA Change: I86T

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089745
AA Change: I86T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087177
Gene: ENSMUSG00000027361
AA Change: I86T

DomainStartEndE-ValueType
Blast:ANK 5 34 4e-9 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103226
AA Change: I86T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099516
Gene: ENSMUSG00000027361
AA Change: I86T

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103227
AA Change: I86T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099517
Gene: ENSMUSG00000027361
AA Change: I86T

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110424
AA Change: I86T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106054
Gene: ENSMUSG00000027361
AA Change: I86T

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 244 N/A INTRINSIC
low complexity region 249 259 N/A INTRINSIC
coiled coil region 328 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110425
AA Change: I86T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106055
Gene: ENSMUSG00000027361
AA Change: I86T

DomainStartEndE-ValueType
Blast:ANK 5 34 3e-8 BLAST
ANK 37 66 3.36e-2 SMART
ANK 70 99 9.7e-8 SMART
ANK 103 132 1.76e-5 SMART
ANK 136 166 3.58e2 SMART
low complexity region 206 245 N/A INTRINSIC
low complexity region 250 260 N/A INTRINSIC
coiled coil region 329 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124972
SMART Domains Protein: ENSMUSP00000117355
Gene: ENSMUSG00000027361

DomainStartEndE-ValueType
Blast:ANK 5 34 1e-10 BLAST
ANK 37 66 3.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130263
Predicted Effect probably benign
Transcript: ENSMUST00000137335
Meta Mutation Damage Score 0.7465 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Gabpb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Gabpb1 APN 2 126653600 missense possibly damaging 0.83
IGL02085:Gabpb1 APN 2 126639271 nonsense probably null
IGL02190:Gabpb1 APN 2 126653549 unclassified probably benign
R0034:Gabpb1 UTSW 2 126658534 missense possibly damaging 0.94
R0800:Gabpb1 UTSW 2 126630328 missense probably damaging 0.99
R0925:Gabpb1 UTSW 2 126652265 missense probably damaging 1.00
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1467:Gabpb1 UTSW 2 126652327 missense probably damaging 0.99
R1497:Gabpb1 UTSW 2 126639249 missense possibly damaging 0.96
R1569:Gabpb1 UTSW 2 126652251 missense probably benign 0.09
R2860:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R2861:Gabpb1 UTSW 2 126653574 missense probably damaging 0.98
R5284:Gabpb1 UTSW 2 126652357 missense possibly damaging 0.93
R5984:Gabpb1 UTSW 2 126646653 missense probably damaging 0.99
R7200:Gabpb1 UTSW 2 126639302 missense possibly damaging 0.73
R7781:Gabpb1 UTSW 2 126639200 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TAGCTCTTCACCCACAAGGCTGAC -3'
(R):5'- GGGAACTTCTCCACTTCATCTGGC -3'

Sequencing Primer
(F):5'- CAAGGCTGACTCTCAATGGTTG -3'
(R):5'- CCGCACAGTATGGGCATTTC -3'
Posted On2013-04-11