Incidental Mutation 'R1858:Nup210l'
ID 206295
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 039882-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R1858 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90061806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 662 (T662A)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably damaging
Transcript: ENSMUST00000029548
AA Change: T662A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: T662A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200410
AA Change: T662A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: T662A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 12,045,177 (GRCm39) A443E unknown Het
Acacb A T 5: 114,334,770 (GRCm39) Y613F probably benign Het
Adam23 A C 1: 63,596,615 (GRCm39) I566L probably benign Het
Adar G T 3: 89,646,589 (GRCm39) R338L probably benign Het
Akap14 C T X: 36,420,779 (GRCm39) A476T probably damaging Het
Amotl1 T A 9: 14,486,697 (GRCm39) Q399L probably benign Het
Ankrd16 T G 2: 11,783,407 (GRCm39) L3R probably benign Het
Arfgap1 G C 2: 180,615,881 (GRCm39) G187R probably damaging Het
Arhgap19 A T 19: 41,767,592 (GRCm39) V399D probably benign Het
Arl4d A G 11: 101,557,578 (GRCm39) T35A probably damaging Het
Atr T A 9: 95,747,150 (GRCm39) I144N probably damaging Het
Bptf A G 11: 106,964,127 (GRCm39) M1574T probably benign Het
Cacna1h T A 17: 25,599,781 (GRCm39) D1684V probably damaging Het
Celsr1 C A 15: 85,916,960 (GRCm39) V338F probably damaging Het
Cep164 T C 9: 45,734,938 (GRCm39) probably benign Het
Clock C A 5: 76,388,756 (GRCm39) G390C possibly damaging Het
Col6a6 A G 9: 105,658,301 (GRCm39) F637S probably damaging Het
Crebrf T A 17: 26,961,937 (GRCm39) Y345N probably benign Het
Cstdc3 A T 16: 36,128,449 (GRCm39) I15F probably damaging Het
Cul1 A G 6: 47,502,458 (GRCm39) probably null Het
Cyb5r4 C T 9: 86,923,332 (GRCm39) S185L probably benign Het
Cyp3a57 T C 5: 145,318,059 (GRCm39) Y347H probably damaging Het
Dgkq G T 5: 108,801,597 (GRCm39) T487K probably benign Het
Dmkn T C 7: 30,463,990 (GRCm39) V143A probably benign Het
Dmp1 A T 5: 104,355,496 (GRCm39) E32V possibly damaging Het
Dsc3 T C 18: 20,098,773 (GRCm39) D802G probably damaging Het
Dse T C 10: 34,029,225 (GRCm39) T622A probably benign Het
Duxf4 A G 10: 58,071,602 (GRCm39) V204A probably benign Het
Dyrk1b A T 7: 27,882,071 (GRCm39) probably null Het
Ehd2 T C 7: 15,686,113 (GRCm39) T320A probably benign Het
Eif3a A C 19: 60,770,635 (GRCm39) L71V probably damaging Het
Eif4e1b A G 13: 54,935,091 (GRCm39) probably null Het
Fam131b A G 6: 42,295,914 (GRCm39) F161L probably damaging Het
Fam171b A T 2: 83,683,725 (GRCm39) M81L probably benign Het
Gal3st4 T C 5: 138,269,050 (GRCm39) probably null Het
Gdf11 A T 10: 128,722,315 (GRCm39) V180E probably damaging Het
Grin3a T A 4: 49,792,437 (GRCm39) Y432F probably benign Het
Hif1a C A 12: 73,990,929 (GRCm39) H708N probably benign Het
Hmcn2 G T 2: 31,305,295 (GRCm39) probably null Het
Hs3st6 T A 17: 24,976,973 (GRCm39) M151K possibly damaging Het
Hyal2 T A 9: 107,449,537 (GRCm39) L431Q probably benign Het
Hyal6 A T 6: 24,740,857 (GRCm39) T337S probably benign Het
Igsf5 A T 16: 96,187,829 (GRCm39) probably null Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Krtap19-3 G A 16: 88,674,878 (GRCm39) probably benign Het
Lgalsl T C 11: 20,779,420 (GRCm39) D75G probably benign Het
Lrrc56 A G 7: 140,787,421 (GRCm39) M353V probably benign Het
Ltbp2 T A 12: 84,877,555 (GRCm39) K337* probably null Het
Mdn1 C T 4: 32,730,881 (GRCm39) H2917Y probably benign Het
Medag A G 5: 149,353,259 (GRCm39) I151M probably damaging Het
Meiob T C 17: 25,042,544 (GRCm39) V124A probably damaging Het
Mmp3 A G 9: 7,451,799 (GRCm39) H379R probably benign Het
Mpg A G 11: 32,181,957 (GRCm39) probably null Het
Ncoa6 G T 2: 155,263,559 (GRCm39) Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 (GRCm39) H277Q probably benign Het
Nlrp4c A G 7: 6,087,655 (GRCm39) I763V probably benign Het
Nlrp5 A T 7: 23,117,586 (GRCm39) I437F probably damaging Het
Noc2l G A 4: 156,329,727 (GRCm39) R435Q probably damaging Het
Nova2 T C 7: 18,692,326 (GRCm39) I485T probably damaging Het
Nrxn2 G A 19: 6,538,825 (GRCm39) V794I probably benign Het
Or2ad1 A T 13: 21,326,564 (GRCm39) I221N probably damaging Het
Or2b28 A G 13: 21,531,346 (GRCm39) M83V possibly damaging Het
Or2p2 A T 13: 21,256,641 (GRCm39) F277I probably damaging Het
Or51aa2 G A 7: 103,187,859 (GRCm39) T194I probably damaging Het
Or51e2 A C 7: 102,391,571 (GRCm39) I213S probably damaging Het
Or51l14 G A 7: 103,101,332 (GRCm39) V263I probably benign Het
Or9g8 T C 2: 85,607,582 (GRCm39) L218P probably damaging Het
Pelp1 G A 11: 70,285,568 (GRCm39) P767S probably damaging Het
Pfdn1 C A 18: 36,584,153 (GRCm39) M60I probably benign Het
Plaat1 G A 16: 29,036,470 (GRCm39) G36D probably damaging Het
Plcxd3 T A 15: 4,546,093 (GRCm39) probably benign Het
Plekhg1 C A 10: 3,895,917 (GRCm39) D436E possibly damaging Het
Ppfibp1 G A 6: 146,892,090 (GRCm39) V117I probably benign Het
Prss44 A G 9: 110,643,177 (GRCm39) K24R probably benign Het
Ptger1 G T 8: 84,395,107 (GRCm39) G195W probably benign Het
Ptgs1 A C 2: 36,132,782 (GRCm39) D260A probably benign Het
Ptprd T A 4: 75,865,384 (GRCm39) T1198S probably damaging Het
Qsox2 A G 2: 26,104,074 (GRCm39) S319P probably damaging Het
Rab35 A G 5: 115,778,147 (GRCm39) I38V probably damaging Het
Rapgef4 A G 2: 71,861,408 (GRCm39) I33V possibly damaging Het
Rbbp8nl C T 2: 179,924,006 (GRCm39) probably benign Het
Riok1 A T 13: 38,242,694 (GRCm39) K473* probably null Het
Rtca C T 3: 116,287,764 (GRCm39) G288S probably benign Het
Sag A T 1: 87,742,570 (GRCm39) D114V probably benign Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sec61g A G 11: 16,456,371 (GRCm39) probably null Het
Sf3a3 A T 4: 124,623,288 (GRCm39) I440F probably damaging Het
Sgta T C 10: 80,884,695 (GRCm39) K205E possibly damaging Het
Slc36a4 A G 9: 15,632,006 (GRCm39) T61A probably damaging Het
Slc5a4a T C 10: 76,002,569 (GRCm39) S242P probably benign Het
Srgap3 A T 6: 112,748,479 (GRCm39) L391Q probably damaging Het
Stard13 T C 5: 151,018,903 (GRCm39) Y60C probably damaging Het
Styxl2 T C 1: 165,928,415 (GRCm39) Y399C possibly damaging Het
Syt12 G T 19: 4,497,825 (GRCm39) H386N probably damaging Het
Thyn1 T A 9: 26,915,070 (GRCm39) M74K probably benign Het
Tmem130 C A 5: 144,689,093 (GRCm39) probably null Het
Trim71 A G 9: 114,392,016 (GRCm39) V57A possibly damaging Het
Twf1 T C 15: 94,483,428 (GRCm39) probably benign Het
Tyro3 T A 2: 119,632,176 (GRCm39) I81N possibly damaging Het
Unc13a A T 8: 72,105,043 (GRCm39) C740S probably damaging Het
Vmn1r15 A T 6: 57,235,616 (GRCm39) K161N probably benign Het
Vmn1r16 A T 6: 57,299,884 (GRCm39) I246N probably damaging Het
Vmn1r42 A G 6: 89,821,597 (GRCm39) I324T probably benign Het
Vmn2r35 T C 7: 7,819,805 (GRCm39) Y155C possibly damaging Het
Wif1 T A 10: 120,919,788 (GRCm39) probably null Het
Wscd2 G A 5: 113,689,231 (GRCm39) R79Q possibly damaging Het
Zan G T 5: 137,404,139 (GRCm39) probably benign Het
Zfp9 G T 6: 118,442,021 (GRCm39) H214N probably benign Het
Zfp985 A T 4: 147,667,315 (GRCm39) Y61F probably benign Het
Zscan30 A G 18: 24,104,524 (GRCm39) noncoding transcript Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAAAAGATTATAGTCTCAGAACAAT -3'
(R):5'- AGCACGCGGTAGACGTAC -3'

Sequencing Primer
(F):5'- CTCTTTGTGGAACAACAATCAGGG -3'
(R):5'- ACGCGGTAGACGTACTGGTTC -3'
Posted On 2014-06-23