Mutagenetix > Incidental Mutation

Incidental Mutation 'R0114:Rusc2'

20630

Institutional Source

Beutler Lab

Gene Symbol

Rusc2

Ensembl Gene

ENSMUSG00000035969

Gene Name

RUN and SH3 domain containing 2

Synonyms

MMRRC Submission

038400-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R0114 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43381979-43427088 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43422055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 825 (C825F)

Ref Sequence

ENSEMBL: ENSMUSP00000095710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000173682]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035645
AA Change: C825F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: C825F

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052829

SMART Domains

Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	47	2.9e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098106
AA Change: C825F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: C825F

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125393

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131668
AA Change: C825F

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: C825F

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146710

Predicted Effect

probably benign
Transcript: ENSMUST00000149221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150066

Predicted Effect

unknown
Transcript: ENSMUST00000173682
AA Change: A720S

SMART Domains

Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969
AA Change: A720S

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	685	703	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154754

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 93.2%
20x: 79.2%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,985,982		probably benign	Het
4933427D14Rik	T	C	11: 72,195,799	Y262C	probably damaging	Het
Adamts1	C	A	16: 85,799,614	V379L	probably benign	Het
Akt3	T	C	1: 177,067,251	D260G	probably damaging	Het
Alms1	T	C	6: 85,619,803	L537P	probably benign	Het
Anln	A	T	9: 22,353,346	I876N	probably damaging	Het
Ano9	A	T	7: 141,103,239		probably benign	Het
Arhgef10l	T	C	4: 140,583,883	E218G	probably benign	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Atp9a	G	T	2: 168,710,856	Y63*	probably null	Het
Bmpr2	G	T	1: 59,815,340	C116F	probably damaging	Het
Cand1	T	C	10: 119,216,522	D233G	probably benign	Het
Cftr	A	T	6: 18,282,448	H1049L	probably damaging	Het
Ckap5	A	T	2: 91,620,112	D1975V	possibly damaging	Het
Cyp26c1	T	C	19: 37,686,633	V134A	probably benign	Het
Dnaic1	T	C	4: 41,605,686		probably benign	Het
Dpp10	T	C	1: 123,486,092	I163V	probably benign	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Fanca	A	T	8: 123,288,491		probably null	Het
Fes	A	G	7: 80,378,035	V787A	probably damaging	Het
Fnip1	C	T	11: 54,487,801		probably benign	Het
Gabpb1	A	G	2: 126,653,574	I86T	probably damaging	Het
Gm1840	A	G	8: 5,640,359		noncoding transcript	Het
Gmds	A	T	13: 32,227,281	S57T	probably benign	Het
Gnpat	T	G	8: 124,883,357	D426E	probably benign	Het
Gnptab	C	A	10: 88,433,400	P655Q	possibly damaging	Het
Herc1	T	A	9: 66,461,846	F2941I	probably damaging	Het
Herc2	T	C	7: 56,153,774		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Itga11	T	C	9: 62,760,302	V639A	possibly damaging	Het
Itga11	T	G	9: 62,735,293	V166G	probably damaging	Het
Itpr2	A	G	6: 146,312,879	F1490S	probably damaging	Het
Lama2	C	A	10: 26,993,068	E802*	probably null	Het
Lgi3	C	T	14: 70,531,029		probably benign	Het
Limch1	C	T	5: 67,036,084		probably benign	Het
Lipc	T	C	9: 70,803,781	N363S	probably damaging	Het
Lrit2	A	G	14: 37,068,045		probably null	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mug2	A	G	6: 122,040,648	Y448C	probably damaging	Het
Mybpc3	A	G	2: 91,124,494	E450G	probably damaging	Het
Myo5b	A	T	18: 74,742,171	T1549S	probably benign	Het
Naa15	T	C	3: 51,448,438		probably null	Het
Nckap1l	T	A	15: 103,455,028	C54S	probably benign	Het
Nlrp9b	A	G	7: 20,024,056	D406G	probably benign	Het
Nprl3	T	A	11: 32,239,784		probably benign	Het
Nvl	A	G	1: 181,120,391	V429A	probably benign	Het
Olfr114	A	T	17: 37,589,415	*313K	probably null	Het
Olfr54	G	A	11: 51,027,604	V201I	probably benign	Het
Olfr548-ps1	A	T	7: 102,542,731	Q265L	probably benign	Het
Olfr801	T	A	10: 129,669,598	Y307F	probably benign	Het
Opa1	A	T	16: 29,629,635	N912Y	probably benign	Het
Pcnx	T	C	12: 81,996,095	V2317A	possibly damaging	Het
Phf3	A	T	1: 30,805,443	N1478K	possibly damaging	Het
Phykpl	G	A	11: 51,586,653	D91N	probably benign	Het
Polr2b	T	A	5: 77,343,263	C984S	probably damaging	Het
Ppfibp1	A	G	6: 146,998,233	R141G	probably benign	Het
Ppm1d	G	A	11: 85,326,905	G20R	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppp2r5b	C	A	19: 6,228,431	V483F	probably benign	Het
Ppp4r4	T	A	12: 103,576,374	C132S	probably benign	Het
Prg2	A	G	2: 84,983,456		probably benign	Het
Prpf4b	G	A	13: 34,890,488		probably benign	Het
Rad54l2	T	C	9: 106,713,455	T491A	probably damaging	Het
Rnf213	G	T	11: 119,414,587	W548L	probably damaging	Het
Sema4b	A	G	7: 80,219,078		probably benign	Het
Sema6a	A	G	18: 47,290,177	V254A	probably damaging	Het
Slc13a3	A	G	2: 165,424,581	F346L	probably damaging	Het
Slc25a17	T	C	15: 81,337,959	D104G	probably damaging	Het
Specc1	A	T	11: 62,146,313	N707Y	possibly damaging	Het
Tex48	T	A	4: 63,608,459	E76V	probably damaging	Het
Tfr2	T	C	5: 137,577,465	V281A	probably benign	Het
Tgfb1i1	A	C	7: 128,249,494	Q238H	probably damaging	Het
Thoc6	G	A	17: 23,670,239	T122I	probably benign	Het
Tmtc1	G	A	6: 148,412,830		probably benign	Het
Tnfrsf8	T	C	4: 145,288,047	D264G	possibly damaging	Het
Trim43a	T	A	9: 88,584,160	I178N	probably damaging	Het
Ttn	G	C	2: 76,707,093	I26503M	possibly damaging	Het
Usp28	C	A	9: 49,039,023	D589E	probably benign	Het
Utp23	T	C	15: 51,882,511	S242P	probably damaging	Het
Vwa3a	A	G	7: 120,775,380	Y305C	probably benign	Het
Vwa5b1	C	A	4: 138,608,858	E142*	probably null	Het
Xrn2	A	T	2: 147,029,779	T374S	probably damaging	Het
Zfp735	A	T	11: 73,710,662	Q144L	probably benign	Het

Other mutations in Rusc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Rusc2	APN	4	43426116	missense	probably damaging	0.97
IGL01474:Rusc2	APN	4	43416434	missense	probably damaging	0.98
IGL01541:Rusc2	APN	4	43415840	missense	probably benign	0.08
IGL01628:Rusc2	APN	4	43425729	missense	probably damaging	1.00
IGL01969:Rusc2	APN	4	43415738	missense	probably benign	0.02
IGL02030:Rusc2	APN	4	43416095	missense	possibly damaging	0.86
IGL02079:Rusc2	APN	4	43425668	missense	probably benign
IGL02115:Rusc2	APN	4	43426136	splice site	probably benign
IGL02122:Rusc2	APN	4	43421685	missense	possibly damaging	0.67
IGL02350:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02357:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02437:Rusc2	APN	4	43415545	missense	probably damaging	1.00
IGL02930:Rusc2	APN	4	43416376	missense	probably damaging	0.99
IGL03154:Rusc2	APN	4	43425806	missense	probably benign	0.00
P0026:Rusc2	UTSW	4	43415840	missense	possibly damaging	0.93
R0036:Rusc2	UTSW	4	43424009	missense	probably damaging	1.00
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0255:Rusc2	UTSW	4	43423954	missense	probably damaging	1.00
R0471:Rusc2	UTSW	4	43425486	missense	probably damaging	0.99
R1381:Rusc2	UTSW	4	43416137	missense	probably damaging	1.00
R1413:Rusc2	UTSW	4	43416568	missense	probably benign	0.00
R1416:Rusc2	UTSW	4	43421617	missense	possibly damaging	0.86
R1731:Rusc2	UTSW	4	43426046	missense	probably benign
R1864:Rusc2	UTSW	4	43421719	missense	possibly damaging	0.49
R1897:Rusc2	UTSW	4	43421749	missense	probably damaging	1.00
R2010:Rusc2	UTSW	4	43415212	missense	probably benign	0.06
R2212:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R2275:Rusc2	UTSW	4	43416260	missense	probably damaging	1.00
R2885:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R2886:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R3412:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3413:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3414:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3852:Rusc2	UTSW	4	43416424	missense	probably benign	0.45
R4135:Rusc2	UTSW	4	43425563	missense	possibly damaging	0.49
R4272:Rusc2	UTSW	4	43415533	missense	probably damaging	1.00
R4574:Rusc2	UTSW	4	43416080	missense	probably damaging	0.99
R4888:Rusc2	UTSW	4	43423942	missense	probably damaging	1.00
R5010:Rusc2	UTSW	4	43415926	missense	probably damaging	1.00
R5071:Rusc2	UTSW	4	43415240	missense	probably benign	0.05
R5131:Rusc2	UTSW	4	43414948	missense	probably benign	0.03
R5177:Rusc2	UTSW	4	43421805	splice site	probably null
R5540:Rusc2	UTSW	4	43423975	missense	probably damaging	1.00
R5561:Rusc2	UTSW	4	43415932	nonsense	probably null
R5628:Rusc2	UTSW	4	43425348	missense	probably damaging	1.00
R5645:Rusc2	UTSW	4	43425758	missense	probably benign	0.06
R6129:Rusc2	UTSW	4	43424271	missense	probably damaging	1.00
R6362:Rusc2	UTSW	4	43416416	missense	probably benign	0.30
R6633:Rusc2	UTSW	4	43414852	missense	probably damaging	0.99
R6980:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R7491:Rusc2	UTSW	4	43426528	missense	probably damaging	1.00
R7641:Rusc2	UTSW	4	43425335	missense	possibly damaging	0.84
R7698:Rusc2	UTSW	4	43414900	nonsense	probably null
R7710:Rusc2	UTSW	4	43416119	missense	probably benign	0.07
R8052:Rusc2	UTSW	4	43421851	missense	probably benign
R8061:Rusc2	UTSW	4	43422492	missense	probably damaging	1.00
R8127:Rusc2	UTSW	4	43423747	missense	possibly damaging	0.54
R8319:Rusc2	UTSW	4	43425378	missense	probably damaging	1.00
R8355:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8397:Rusc2	UTSW	4	43424206	missense	possibly damaging	0.95
R8455:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8553:Rusc2	UTSW	4	43416508	missense	probably benign	0.05
R8725:Rusc2	UTSW	4	43401351	intron	probably benign
R8725:Rusc2	UTSW	4	43415396	missense	probably damaging	0.99
R8727:Rusc2	UTSW	4	43401351	intron	probably benign
R8834:Rusc2	UTSW	4	43416431	missense	possibly damaging	0.94
R9295:Rusc2	UTSW	4	43416382	missense	probably damaging	0.98
R9483:Rusc2	UTSW	4	43415897	missense	probably damaging	0.97
R9666:Rusc2	UTSW	4	43416262	missense	probably benign	0.21
R9705:Rusc2	UTSW	4	43424936	missense	probably benign	0.00
X0025:Rusc2	UTSW	4	43422226	missense	probably benign	0.00
X0066:Rusc2	UTSW	4	43422204	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCGCTGGTTATCTCTACTGCTCAAG -3'
(R):5'- GCTAGGCCAACATGTCAATCACCTC -3'

Sequencing Primer
(F):5'- TCTACTGCTCAAGGCCCAG -3'
(R):5'- GCTTGGAATGAAGCTCGTACC -3'

Posted On

2013-04-11