Incidental Mutation 'R1858:Acacb'
ID206311
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission 039882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1858 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114196709 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 613 (Y613F)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect probably benign
Transcript: ENSMUST00000031583
AA Change: Y613F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: Y613F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
AA Change: Y613F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: Y613F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,974,953 A443E unknown Het
Adam23 A C 1: 63,557,456 I566L probably benign Het
Adar G T 3: 89,739,282 R338L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amotl1 T A 9: 14,575,401 Q399L probably benign Het
Ankrd16 T G 2: 11,778,596 L3R probably benign Het
Arfgap1 G C 2: 180,974,088 G187R probably damaging Het
Arhgap19 A T 19: 41,779,153 V399D probably benign Het
Arl4d A G 11: 101,666,752 T35A probably damaging Het
Atr T A 9: 95,865,097 I144N probably damaging Het
Bptf A G 11: 107,073,301 M1574T probably benign Het
Cacna1h T A 17: 25,380,807 D1684V probably damaging Het
Celsr1 C A 15: 86,032,759 V338F probably damaging Het
Cep164 T C 9: 45,823,640 probably benign Het
Clock C A 5: 76,240,909 G390C possibly damaging Het
Col6a6 A G 9: 105,781,102 F637S probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cul1 A G 6: 47,525,524 probably null Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp3a57 T C 5: 145,381,249 Y347H probably damaging Het
Dgkq G T 5: 108,653,731 T487K probably benign Het
Dmkn T C 7: 30,764,565 V143A probably benign Het
Dmp1 A T 5: 104,207,630 E32V possibly damaging Het
Dsc3 T C 18: 19,965,716 D802G probably damaging Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dusp27 T C 1: 166,100,846 Y399C possibly damaging Het
Dyrk1b A T 7: 28,182,646 probably null Het
Ehd2 T C 7: 15,952,188 T320A probably benign Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif4e1b A G 13: 54,787,278 probably null Het
Fam131b A G 6: 42,318,980 F161L probably damaging Het
Fam171b A T 2: 83,853,381 M81L probably benign Het
Gal3st4 T C 5: 138,270,788 probably null Het
Gdf11 A T 10: 128,886,446 V180E probably damaging Het
Gm4758 A T 16: 36,308,087 I15F probably damaging Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Grin3a T A 4: 49,792,437 Y432F probably benign Het
Hif1a C A 12: 73,944,155 H708N probably benign Het
Hmcn2 G T 2: 31,415,283 probably null Het
Hrasls G A 16: 29,217,718 G36D probably damaging Het
Hs3st6 T A 17: 24,757,999 M151K possibly damaging Het
Hyal2 T A 9: 107,572,338 L431Q probably benign Het
Hyal6 A T 6: 24,740,858 T337S probably benign Het
Igsf5 A T 16: 96,386,629 probably null Het
Kif13a G A 13: 46,864,838 probably benign Het
Krtap19-3 G A 16: 88,877,990 probably benign Het
Lgalsl T C 11: 20,829,420 D75G probably benign Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Ltbp2 T A 12: 84,830,781 K337* probably null Het
Mdn1 C T 4: 32,730,881 H2917Y probably benign Het
Medag A G 5: 149,429,794 I151M probably damaging Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp3 A G 9: 7,451,799 H379R probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Ncoa6 G T 2: 155,421,639 Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nlrp4c A G 7: 6,084,656 I763V probably benign Het
Nlrp5 A T 7: 23,418,161 I437F probably damaging Het
Noc2l G A 4: 156,245,270 R435Q probably damaging Het
Nova2 T C 7: 18,958,401 I485T probably damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Nup210l A G 3: 90,154,499 T662A probably damaging Het
Olfr1014 T C 2: 85,777,238 L218P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr1368 A T 13: 21,142,394 I221N probably damaging Het
Olfr1370 A T 13: 21,072,471 F277I probably damaging Het
Olfr606 G A 7: 103,452,125 V263I probably benign Het
Olfr612 G A 7: 103,538,652 T194I probably damaging Het
Olfr78 A C 7: 102,742,364 I213S probably damaging Het
Pelp1 G A 11: 70,394,742 P767S probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Plcxd3 T A 15: 4,516,611 probably benign Het
Plekhg1 C A 10: 3,945,917 D436E possibly damaging Het
Ppfibp1 G A 6: 146,990,592 V117I probably benign Het
Prss44 A G 9: 110,814,109 K24R probably benign Het
Ptger1 G T 8: 83,668,478 G195W probably benign Het
Ptgs1 A C 2: 36,242,770 D260A probably benign Het
Ptprd T A 4: 75,947,147 T1198S probably damaging Het
Qsox2 A G 2: 26,214,062 S319P probably damaging Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rapgef4 A G 2: 72,031,064 I33V possibly damaging Het
Rbbp8nl C T 2: 180,282,213 probably benign Het
Riok1 A T 13: 38,058,718 K473* probably null Het
Rtca C T 3: 116,494,115 G288S probably benign Het
Sag A T 1: 87,814,848 D114V probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sec61g A G 11: 16,506,371 probably null Het
Sf3a3 A T 4: 124,729,495 I440F probably damaging Het
Sgta T C 10: 81,048,861 K205E possibly damaging Het
Slc36a4 A G 9: 15,720,710 T61A probably damaging Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Srgap3 A T 6: 112,771,518 L391Q probably damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Syt12 G T 19: 4,447,797 H386N probably damaging Het
Thyn1 T A 9: 27,003,774 M74K probably benign Het
Tmem130 C A 5: 144,752,283 probably null Het
Trim71 A G 9: 114,562,948 V57A possibly damaging Het
Twf1 T C 15: 94,585,547 probably benign Het
Tyro3 T A 2: 119,801,695 I81N possibly damaging Het
Unc13a A T 8: 71,652,399 C740S probably damaging Het
Vmn1r15 A T 6: 57,258,631 K161N probably benign Het
Vmn1r16 A T 6: 57,322,899 I246N probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vmn2r35 T C 7: 7,816,806 Y155C possibly damaging Het
Wif1 T A 10: 121,083,883 probably null Het
Wscd2 G A 5: 113,551,170 R79Q possibly damaging Het
Zan G T 5: 137,405,877 probably benign Het
Zfp9 G T 6: 118,465,060 H214N probably benign Het
Zfp985 A T 4: 147,582,858 Y61F probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGTGTTAACTGAGCCTCCTCTTC -3'
(R):5'- ATTCTGAGTGCCAGCATACCC -3'

Sequencing Primer
(F):5'- CTTCACATCCACTGTTATAGGCTCAG -3'
(R):5'- GTGCCAGCATACCCACACC -3'
Posted On2014-06-23