Incidental Mutation 'R1858:Acacb'
ID 206311
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 039882-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1858 (G1)
Quality Score 211
Status Validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114334770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 613 (Y613F)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably benign
Transcript: ENSMUST00000031583
AA Change: Y613F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: Y613F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
AA Change: Y613F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: Y613F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 12,045,177 (GRCm39) A443E unknown Het
Adam23 A C 1: 63,596,615 (GRCm39) I566L probably benign Het
Adar G T 3: 89,646,589 (GRCm39) R338L probably benign Het
Akap14 C T X: 36,420,779 (GRCm39) A476T probably damaging Het
Amotl1 T A 9: 14,486,697 (GRCm39) Q399L probably benign Het
Ankrd16 T G 2: 11,783,407 (GRCm39) L3R probably benign Het
Arfgap1 G C 2: 180,615,881 (GRCm39) G187R probably damaging Het
Arhgap19 A T 19: 41,767,592 (GRCm39) V399D probably benign Het
Arl4d A G 11: 101,557,578 (GRCm39) T35A probably damaging Het
Atr T A 9: 95,747,150 (GRCm39) I144N probably damaging Het
Bptf A G 11: 106,964,127 (GRCm39) M1574T probably benign Het
Cacna1h T A 17: 25,599,781 (GRCm39) D1684V probably damaging Het
Celsr1 C A 15: 85,916,960 (GRCm39) V338F probably damaging Het
Cep164 T C 9: 45,734,938 (GRCm39) probably benign Het
Clock C A 5: 76,388,756 (GRCm39) G390C possibly damaging Het
Col6a6 A G 9: 105,658,301 (GRCm39) F637S probably damaging Het
Crebrf T A 17: 26,961,937 (GRCm39) Y345N probably benign Het
Cstdc3 A T 16: 36,128,449 (GRCm39) I15F probably damaging Het
Cul1 A G 6: 47,502,458 (GRCm39) probably null Het
Cyb5r4 C T 9: 86,923,332 (GRCm39) S185L probably benign Het
Cyp3a57 T C 5: 145,318,059 (GRCm39) Y347H probably damaging Het
Dgkq G T 5: 108,801,597 (GRCm39) T487K probably benign Het
Dmkn T C 7: 30,463,990 (GRCm39) V143A probably benign Het
Dmp1 A T 5: 104,355,496 (GRCm39) E32V possibly damaging Het
Dsc3 T C 18: 20,098,773 (GRCm39) D802G probably damaging Het
Dse T C 10: 34,029,225 (GRCm39) T622A probably benign Het
Duxf4 A G 10: 58,071,602 (GRCm39) V204A probably benign Het
Dyrk1b A T 7: 27,882,071 (GRCm39) probably null Het
Ehd2 T C 7: 15,686,113 (GRCm39) T320A probably benign Het
Eif3a A C 19: 60,770,635 (GRCm39) L71V probably damaging Het
Eif4e1b A G 13: 54,935,091 (GRCm39) probably null Het
Fam131b A G 6: 42,295,914 (GRCm39) F161L probably damaging Het
Fam171b A T 2: 83,683,725 (GRCm39) M81L probably benign Het
Gal3st4 T C 5: 138,269,050 (GRCm39) probably null Het
Gdf11 A T 10: 128,722,315 (GRCm39) V180E probably damaging Het
Grin3a T A 4: 49,792,437 (GRCm39) Y432F probably benign Het
Hif1a C A 12: 73,990,929 (GRCm39) H708N probably benign Het
Hmcn2 G T 2: 31,305,295 (GRCm39) probably null Het
Hs3st6 T A 17: 24,976,973 (GRCm39) M151K possibly damaging Het
Hyal2 T A 9: 107,449,537 (GRCm39) L431Q probably benign Het
Hyal6 A T 6: 24,740,857 (GRCm39) T337S probably benign Het
Igsf5 A T 16: 96,187,829 (GRCm39) probably null Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Krtap19-3 G A 16: 88,674,878 (GRCm39) probably benign Het
Lgalsl T C 11: 20,779,420 (GRCm39) D75G probably benign Het
Lrrc56 A G 7: 140,787,421 (GRCm39) M353V probably benign Het
Ltbp2 T A 12: 84,877,555 (GRCm39) K337* probably null Het
Mdn1 C T 4: 32,730,881 (GRCm39) H2917Y probably benign Het
Medag A G 5: 149,353,259 (GRCm39) I151M probably damaging Het
Meiob T C 17: 25,042,544 (GRCm39) V124A probably damaging Het
Mmp3 A G 9: 7,451,799 (GRCm39) H379R probably benign Het
Mpg A G 11: 32,181,957 (GRCm39) probably null Het
Ncoa6 G T 2: 155,263,559 (GRCm39) Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 (GRCm39) H277Q probably benign Het
Nlrp4c A G 7: 6,087,655 (GRCm39) I763V probably benign Het
Nlrp5 A T 7: 23,117,586 (GRCm39) I437F probably damaging Het
Noc2l G A 4: 156,329,727 (GRCm39) R435Q probably damaging Het
Nova2 T C 7: 18,692,326 (GRCm39) I485T probably damaging Het
Nrxn2 G A 19: 6,538,825 (GRCm39) V794I probably benign Het
Nup210l A G 3: 90,061,806 (GRCm39) T662A probably damaging Het
Or2ad1 A T 13: 21,326,564 (GRCm39) I221N probably damaging Het
Or2b28 A G 13: 21,531,346 (GRCm39) M83V possibly damaging Het
Or2p2 A T 13: 21,256,641 (GRCm39) F277I probably damaging Het
Or51aa2 G A 7: 103,187,859 (GRCm39) T194I probably damaging Het
Or51e2 A C 7: 102,391,571 (GRCm39) I213S probably damaging Het
Or51l14 G A 7: 103,101,332 (GRCm39) V263I probably benign Het
Or9g8 T C 2: 85,607,582 (GRCm39) L218P probably damaging Het
Pelp1 G A 11: 70,285,568 (GRCm39) P767S probably damaging Het
Pfdn1 C A 18: 36,584,153 (GRCm39) M60I probably benign Het
Plaat1 G A 16: 29,036,470 (GRCm39) G36D probably damaging Het
Plcxd3 T A 15: 4,546,093 (GRCm39) probably benign Het
Plekhg1 C A 10: 3,895,917 (GRCm39) D436E possibly damaging Het
Ppfibp1 G A 6: 146,892,090 (GRCm39) V117I probably benign Het
Prss44 A G 9: 110,643,177 (GRCm39) K24R probably benign Het
Ptger1 G T 8: 84,395,107 (GRCm39) G195W probably benign Het
Ptgs1 A C 2: 36,132,782 (GRCm39) D260A probably benign Het
Ptprd T A 4: 75,865,384 (GRCm39) T1198S probably damaging Het
Qsox2 A G 2: 26,104,074 (GRCm39) S319P probably damaging Het
Rab35 A G 5: 115,778,147 (GRCm39) I38V probably damaging Het
Rapgef4 A G 2: 71,861,408 (GRCm39) I33V possibly damaging Het
Rbbp8nl C T 2: 179,924,006 (GRCm39) probably benign Het
Riok1 A T 13: 38,242,694 (GRCm39) K473* probably null Het
Rtca C T 3: 116,287,764 (GRCm39) G288S probably benign Het
Sag A T 1: 87,742,570 (GRCm39) D114V probably benign Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sec61g A G 11: 16,456,371 (GRCm39) probably null Het
Sf3a3 A T 4: 124,623,288 (GRCm39) I440F probably damaging Het
Sgta T C 10: 80,884,695 (GRCm39) K205E possibly damaging Het
Slc36a4 A G 9: 15,632,006 (GRCm39) T61A probably damaging Het
Slc5a4a T C 10: 76,002,569 (GRCm39) S242P probably benign Het
Srgap3 A T 6: 112,748,479 (GRCm39) L391Q probably damaging Het
Stard13 T C 5: 151,018,903 (GRCm39) Y60C probably damaging Het
Styxl2 T C 1: 165,928,415 (GRCm39) Y399C possibly damaging Het
Syt12 G T 19: 4,497,825 (GRCm39) H386N probably damaging Het
Thyn1 T A 9: 26,915,070 (GRCm39) M74K probably benign Het
Tmem130 C A 5: 144,689,093 (GRCm39) probably null Het
Trim71 A G 9: 114,392,016 (GRCm39) V57A possibly damaging Het
Twf1 T C 15: 94,483,428 (GRCm39) probably benign Het
Tyro3 T A 2: 119,632,176 (GRCm39) I81N possibly damaging Het
Unc13a A T 8: 72,105,043 (GRCm39) C740S probably damaging Het
Vmn1r15 A T 6: 57,235,616 (GRCm39) K161N probably benign Het
Vmn1r16 A T 6: 57,299,884 (GRCm39) I246N probably damaging Het
Vmn1r42 A G 6: 89,821,597 (GRCm39) I324T probably benign Het
Vmn2r35 T C 7: 7,819,805 (GRCm39) Y155C possibly damaging Het
Wif1 T A 10: 120,919,788 (GRCm39) probably null Het
Wscd2 G A 5: 113,689,231 (GRCm39) R79Q possibly damaging Het
Zan G T 5: 137,404,139 (GRCm39) probably benign Het
Zfp9 G T 6: 118,442,021 (GRCm39) H214N probably benign Het
Zfp985 A T 4: 147,667,315 (GRCm39) Y61F probably benign Het
Zscan30 A G 18: 24,104,524 (GRCm39) noncoding transcript Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGTGTTAACTGAGCCTCCTCTTC -3'
(R):5'- ATTCTGAGTGCCAGCATACCC -3'

Sequencing Primer
(F):5'- CTTCACATCCACTGTTATAGGCTCAG -3'
(R):5'- GTGCCAGCATACCCACACC -3'
Posted On 2014-06-23