Mutagenetix > Incidental Mutation

Incidental Mutation 'R0114:Tnfrsf8'

20635

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf8

Ensembl Gene

ENSMUSG00000028602

Gene Name

tumor necrosis factor receptor superfamily, member 8

Synonyms

CD30

MMRRC Submission

038400-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R0114 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

145267137-145315164 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 145288047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 264 (D264G)

Ref Sequence

ENSEMBL: ENSMUSP00000030339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]

AlphaFold

Q60846

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030339
AA Change: D264G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: D264G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TNFR	29	65	2.33e0	SMART
TNFR	69	105	5.51e-7	SMART
TNFR	107	146	2.87e-5	SMART
low complexity region	149	161	N/A	INTRINSIC
transmembrane domain	288	310	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123027
AA Change: D264G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602
AA Change: D264G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TNFR	29	65	2.33e0	SMART
TNFR	69	105	5.51e-7	SMART
TNFR	107	146	2.87e-5	SMART
low complexity region	149	161	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 98.6%
3x: 97.4%
10x: 93.2%
20x: 79.2%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	T	C	10: 28,985,982		probably benign	Het
4933427D14Rik	T	C	11: 72,195,799	Y262C	probably damaging	Het
Adamts1	C	A	16: 85,799,614	V379L	probably benign	Het
Akt3	T	C	1: 177,067,251	D260G	probably damaging	Het
Alms1	T	C	6: 85,619,803	L537P	probably benign	Het
Anln	A	T	9: 22,353,346	I876N	probably damaging	Het
Ano9	A	T	7: 141,103,239		probably benign	Het
Arhgef10l	T	C	4: 140,583,883	E218G	probably benign	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Atp9a	G	T	2: 168,710,856	Y63*	probably null	Het
Bmpr2	G	T	1: 59,815,340	C116F	probably damaging	Het
Cand1	T	C	10: 119,216,522	D233G	probably benign	Het
Cftr	A	T	6: 18,282,448	H1049L	probably damaging	Het
Ckap5	A	T	2: 91,620,112	D1975V	possibly damaging	Het
Cyp26c1	T	C	19: 37,686,633	V134A	probably benign	Het
Dnaic1	T	C	4: 41,605,686		probably benign	Het
Dpp10	T	C	1: 123,486,092	I163V	probably benign	Het
Fam151a	A	T	4: 106,734,004	I15F	possibly damaging	Het
Fanca	A	T	8: 123,288,491		probably null	Het
Fes	A	G	7: 80,378,035	V787A	probably damaging	Het
Fnip1	C	T	11: 54,487,801		probably benign	Het
Gabpb1	A	G	2: 126,653,574	I86T	probably damaging	Het
Gm1840	A	G	8: 5,640,359		noncoding transcript	Het
Gmds	A	T	13: 32,227,281	S57T	probably benign	Het
Gnpat	T	G	8: 124,883,357	D426E	probably benign	Het
Gnptab	C	A	10: 88,433,400	P655Q	possibly damaging	Het
Herc1	T	A	9: 66,461,846	F2941I	probably damaging	Het
Herc2	T	C	7: 56,153,774		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Itga11	T	G	9: 62,735,293	V166G	probably damaging	Het
Itga11	T	C	9: 62,760,302	V639A	possibly damaging	Het
Itpr2	A	G	6: 146,312,879	F1490S	probably damaging	Het
Lama2	C	A	10: 26,993,068	E802*	probably null	Het
Lgi3	C	T	14: 70,531,029		probably benign	Het
Limch1	C	T	5: 67,036,084		probably benign	Het
Lipc	T	C	9: 70,803,781	N363S	probably damaging	Het
Lrit2	A	G	14: 37,068,045		probably null	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mug2	A	G	6: 122,040,648	Y448C	probably damaging	Het
Mybpc3	A	G	2: 91,124,494	E450G	probably damaging	Het
Myo5b	A	T	18: 74,742,171	T1549S	probably benign	Het
Naa15	T	C	3: 51,448,438		probably null	Het
Nckap1l	T	A	15: 103,455,028	C54S	probably benign	Het
Nlrp9b	A	G	7: 20,024,056	D406G	probably benign	Het
Nprl3	T	A	11: 32,239,784		probably benign	Het
Nvl	A	G	1: 181,120,391	V429A	probably benign	Het
Olfr114	A	T	17: 37,589,415	*313K	probably null	Het
Olfr54	G	A	11: 51,027,604	V201I	probably benign	Het
Olfr548-ps1	A	T	7: 102,542,731	Q265L	probably benign	Het
Olfr801	T	A	10: 129,669,598	Y307F	probably benign	Het
Opa1	A	T	16: 29,629,635	N912Y	probably benign	Het
Pcnx	T	C	12: 81,996,095	V2317A	possibly damaging	Het
Phf3	A	T	1: 30,805,443	N1478K	possibly damaging	Het
Phykpl	G	A	11: 51,586,653	D91N	probably benign	Het
Polr2b	T	A	5: 77,343,263	C984S	probably damaging	Het
Ppfibp1	A	G	6: 146,998,233	R141G	probably benign	Het
Ppm1d	G	A	11: 85,326,905	G20R	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppp2r5b	C	A	19: 6,228,431	V483F	probably benign	Het
Ppp4r4	T	A	12: 103,576,374	C132S	probably benign	Het
Prg2	A	G	2: 84,983,456		probably benign	Het
Prpf4b	G	A	13: 34,890,488		probably benign	Het
Rad54l2	T	C	9: 106,713,455	T491A	probably damaging	Het
Rnf213	G	T	11: 119,414,587	W548L	probably damaging	Het
Rusc2	G	T	4: 43,422,055	C825F	probably damaging	Het
Sema4b	A	G	7: 80,219,078		probably benign	Het
Sema6a	A	G	18: 47,290,177	V254A	probably damaging	Het
Slc13a3	A	G	2: 165,424,581	F346L	probably damaging	Het
Slc25a17	T	C	15: 81,337,959	D104G	probably damaging	Het
Specc1	A	T	11: 62,146,313	N707Y	possibly damaging	Het
Tex48	T	A	4: 63,608,459	E76V	probably damaging	Het
Tfr2	T	C	5: 137,577,465	V281A	probably benign	Het
Tgfb1i1	A	C	7: 128,249,494	Q238H	probably damaging	Het
Thoc6	G	A	17: 23,670,239	T122I	probably benign	Het
Tmtc1	G	A	6: 148,412,830		probably benign	Het
Trim43a	T	A	9: 88,584,160	I178N	probably damaging	Het
Ttn	G	C	2: 76,707,093	I26503M	possibly damaging	Het
Usp28	C	A	9: 49,039,023	D589E	probably benign	Het
Utp23	T	C	15: 51,882,511	S242P	probably damaging	Het
Vwa3a	A	G	7: 120,775,380	Y305C	probably benign	Het
Vwa5b1	C	A	4: 138,608,858	E142*	probably null	Het
Xrn2	A	T	2: 147,029,779	T374S	probably damaging	Het
Zfp735	A	T	11: 73,710,662	Q144L	probably benign	Het

Other mutations in Tnfrsf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Tnfrsf8	APN	4	145292591	splice site	probably null
IGL02815:Tnfrsf8	APN	4	145298778	missense	possibly damaging	0.68
IGL02819:Tnfrsf8	APN	4	145269133	missense	probably damaging	1.00
IGL03033:Tnfrsf8	APN	4	145292649	missense	possibly damaging	0.86
IGL03105:Tnfrsf8	APN	4	145298784	missense	probably damaging	1.00
IGL02837:Tnfrsf8	UTSW	4	145268998	missense	probably benign	0.10
R0326:Tnfrsf8	UTSW	4	145288459	missense	possibly damaging	0.64
R0594:Tnfrsf8	UTSW	4	145296861	missense	probably damaging	1.00
R0639:Tnfrsf8	UTSW	4	145288027	missense	probably benign	0.24
R0826:Tnfrsf8	UTSW	4	145285138	splice site	probably benign
R3056:Tnfrsf8	UTSW	4	145285325	critical splice donor site	probably null
R4700:Tnfrsf8	UTSW	4	145303122	missense	probably damaging	0.99
R4765:Tnfrsf8	UTSW	4	145296877	missense	probably benign	0.19
R5149:Tnfrsf8	UTSW	4	145303105	missense	possibly damaging	0.53
R5452:Tnfrsf8	UTSW	4	145292644	missense	possibly damaging	0.96
R5632:Tnfrsf8	UTSW	4	145292633	missense	possibly damaging	0.68
R5673:Tnfrsf8	UTSW	4	145285335	missense	probably benign	0.14
R5877:Tnfrsf8	UTSW	4	145292687	missense	probably benign	0.20
R6243:Tnfrsf8	UTSW	4	145303101	missense	possibly damaging	0.61
R6259:Tnfrsf8	UTSW	4	145277524	critical splice donor site	probably null
R6326:Tnfrsf8	UTSW	4	145269224	missense	probably damaging	1.00
R6603:Tnfrsf8	UTSW	4	145292598	missense	possibly damaging	0.70
R7025:Tnfrsf8	UTSW	4	145274403	missense	possibly damaging	0.87
R7156:Tnfrsf8	UTSW	4	145315084	start codon destroyed	unknown
R7313:Tnfrsf8	UTSW	4	145274382	missense	probably benign	0.33
R7505:Tnfrsf8	UTSW	4	145269115	missense	probably damaging	1.00
R8255:Tnfrsf8	UTSW	4	145315083	start codon destroyed	probably null
R8354:Tnfrsf8	UTSW	4	145287983	missense	probably benign	0.41
R8406:Tnfrsf8	UTSW	4	145292695	missense	probably damaging	0.98
R8454:Tnfrsf8	UTSW	4	145287983	missense	probably benign	0.41
R8554:Tnfrsf8	UTSW	4	145296941	missense	probably damaging	1.00
R8894:Tnfrsf8	UTSW	4	145274468	missense	possibly damaging	0.94
R9125:Tnfrsf8	UTSW	4	145296961	missense	probably damaging	1.00
R9711:Tnfrsf8	UTSW	4	145293098	critical splice donor site	probably null
Z1177:Tnfrsf8	UTSW	4	145292709	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TGAGCCACTTCATTGATCCAACCC -3'
(R):5'- CTCAGGCAGTGTCCAGGAAAGTAAG -3'

Sequencing Primer
(F):5'- gacatacactacgaagcccc -3'
(R):5'- CCAGAGGGTCTAGAGCTTAATC -3'

Posted On

2013-04-11