Incidental Mutation 'R1858:Slc5a4a'
ID 206354
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
MMRRC Submission 039882-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1858 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 75983285-76025099 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76002569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 242 (S242P)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020450
AA Change: S242P

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: S242P

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Meta Mutation Damage Score 0.1672 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 12,045,177 (GRCm39) A443E unknown Het
Acacb A T 5: 114,334,770 (GRCm39) Y613F probably benign Het
Adam23 A C 1: 63,596,615 (GRCm39) I566L probably benign Het
Adar G T 3: 89,646,589 (GRCm39) R338L probably benign Het
Akap14 C T X: 36,420,779 (GRCm39) A476T probably damaging Het
Amotl1 T A 9: 14,486,697 (GRCm39) Q399L probably benign Het
Ankrd16 T G 2: 11,783,407 (GRCm39) L3R probably benign Het
Arfgap1 G C 2: 180,615,881 (GRCm39) G187R probably damaging Het
Arhgap19 A T 19: 41,767,592 (GRCm39) V399D probably benign Het
Arl4d A G 11: 101,557,578 (GRCm39) T35A probably damaging Het
Atr T A 9: 95,747,150 (GRCm39) I144N probably damaging Het
Bptf A G 11: 106,964,127 (GRCm39) M1574T probably benign Het
Cacna1h T A 17: 25,599,781 (GRCm39) D1684V probably damaging Het
Celsr1 C A 15: 85,916,960 (GRCm39) V338F probably damaging Het
Cep164 T C 9: 45,734,938 (GRCm39) probably benign Het
Clock C A 5: 76,388,756 (GRCm39) G390C possibly damaging Het
Col6a6 A G 9: 105,658,301 (GRCm39) F637S probably damaging Het
Crebrf T A 17: 26,961,937 (GRCm39) Y345N probably benign Het
Cstdc3 A T 16: 36,128,449 (GRCm39) I15F probably damaging Het
Cul1 A G 6: 47,502,458 (GRCm39) probably null Het
Cyb5r4 C T 9: 86,923,332 (GRCm39) S185L probably benign Het
Cyp3a57 T C 5: 145,318,059 (GRCm39) Y347H probably damaging Het
Dgkq G T 5: 108,801,597 (GRCm39) T487K probably benign Het
Dmkn T C 7: 30,463,990 (GRCm39) V143A probably benign Het
Dmp1 A T 5: 104,355,496 (GRCm39) E32V possibly damaging Het
Dsc3 T C 18: 20,098,773 (GRCm39) D802G probably damaging Het
Dse T C 10: 34,029,225 (GRCm39) T622A probably benign Het
Duxf4 A G 10: 58,071,602 (GRCm39) V204A probably benign Het
Dyrk1b A T 7: 27,882,071 (GRCm39) probably null Het
Ehd2 T C 7: 15,686,113 (GRCm39) T320A probably benign Het
Eif3a A C 19: 60,770,635 (GRCm39) L71V probably damaging Het
Eif4e1b A G 13: 54,935,091 (GRCm39) probably null Het
Fam131b A G 6: 42,295,914 (GRCm39) F161L probably damaging Het
Fam171b A T 2: 83,683,725 (GRCm39) M81L probably benign Het
Gal3st4 T C 5: 138,269,050 (GRCm39) probably null Het
Gdf11 A T 10: 128,722,315 (GRCm39) V180E probably damaging Het
Grin3a T A 4: 49,792,437 (GRCm39) Y432F probably benign Het
Hif1a C A 12: 73,990,929 (GRCm39) H708N probably benign Het
Hmcn2 G T 2: 31,305,295 (GRCm39) probably null Het
Hs3st6 T A 17: 24,976,973 (GRCm39) M151K possibly damaging Het
Hyal2 T A 9: 107,449,537 (GRCm39) L431Q probably benign Het
Hyal6 A T 6: 24,740,857 (GRCm39) T337S probably benign Het
Igsf5 A T 16: 96,187,829 (GRCm39) probably null Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Krtap19-3 G A 16: 88,674,878 (GRCm39) probably benign Het
Lgalsl T C 11: 20,779,420 (GRCm39) D75G probably benign Het
Lrrc56 A G 7: 140,787,421 (GRCm39) M353V probably benign Het
Ltbp2 T A 12: 84,877,555 (GRCm39) K337* probably null Het
Mdn1 C T 4: 32,730,881 (GRCm39) H2917Y probably benign Het
Medag A G 5: 149,353,259 (GRCm39) I151M probably damaging Het
Meiob T C 17: 25,042,544 (GRCm39) V124A probably damaging Het
Mmp3 A G 9: 7,451,799 (GRCm39) H379R probably benign Het
Mpg A G 11: 32,181,957 (GRCm39) probably null Het
Ncoa6 G T 2: 155,263,559 (GRCm39) Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 (GRCm39) H277Q probably benign Het
Nlrp4c A G 7: 6,087,655 (GRCm39) I763V probably benign Het
Nlrp5 A T 7: 23,117,586 (GRCm39) I437F probably damaging Het
Noc2l G A 4: 156,329,727 (GRCm39) R435Q probably damaging Het
Nova2 T C 7: 18,692,326 (GRCm39) I485T probably damaging Het
Nrxn2 G A 19: 6,538,825 (GRCm39) V794I probably benign Het
Nup210l A G 3: 90,061,806 (GRCm39) T662A probably damaging Het
Or2ad1 A T 13: 21,326,564 (GRCm39) I221N probably damaging Het
Or2b28 A G 13: 21,531,346 (GRCm39) M83V possibly damaging Het
Or2p2 A T 13: 21,256,641 (GRCm39) F277I probably damaging Het
Or51aa2 G A 7: 103,187,859 (GRCm39) T194I probably damaging Het
Or51e2 A C 7: 102,391,571 (GRCm39) I213S probably damaging Het
Or51l14 G A 7: 103,101,332 (GRCm39) V263I probably benign Het
Or9g8 T C 2: 85,607,582 (GRCm39) L218P probably damaging Het
Pelp1 G A 11: 70,285,568 (GRCm39) P767S probably damaging Het
Pfdn1 C A 18: 36,584,153 (GRCm39) M60I probably benign Het
Plaat1 G A 16: 29,036,470 (GRCm39) G36D probably damaging Het
Plcxd3 T A 15: 4,546,093 (GRCm39) probably benign Het
Plekhg1 C A 10: 3,895,917 (GRCm39) D436E possibly damaging Het
Ppfibp1 G A 6: 146,892,090 (GRCm39) V117I probably benign Het
Prss44 A G 9: 110,643,177 (GRCm39) K24R probably benign Het
Ptger1 G T 8: 84,395,107 (GRCm39) G195W probably benign Het
Ptgs1 A C 2: 36,132,782 (GRCm39) D260A probably benign Het
Ptprd T A 4: 75,865,384 (GRCm39) T1198S probably damaging Het
Qsox2 A G 2: 26,104,074 (GRCm39) S319P probably damaging Het
Rab35 A G 5: 115,778,147 (GRCm39) I38V probably damaging Het
Rapgef4 A G 2: 71,861,408 (GRCm39) I33V possibly damaging Het
Rbbp8nl C T 2: 179,924,006 (GRCm39) probably benign Het
Riok1 A T 13: 38,242,694 (GRCm39) K473* probably null Het
Rtca C T 3: 116,287,764 (GRCm39) G288S probably benign Het
Sag A T 1: 87,742,570 (GRCm39) D114V probably benign Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sec61g A G 11: 16,456,371 (GRCm39) probably null Het
Sf3a3 A T 4: 124,623,288 (GRCm39) I440F probably damaging Het
Sgta T C 10: 80,884,695 (GRCm39) K205E possibly damaging Het
Slc36a4 A G 9: 15,632,006 (GRCm39) T61A probably damaging Het
Srgap3 A T 6: 112,748,479 (GRCm39) L391Q probably damaging Het
Stard13 T C 5: 151,018,903 (GRCm39) Y60C probably damaging Het
Styxl2 T C 1: 165,928,415 (GRCm39) Y399C possibly damaging Het
Syt12 G T 19: 4,497,825 (GRCm39) H386N probably damaging Het
Thyn1 T A 9: 26,915,070 (GRCm39) M74K probably benign Het
Tmem130 C A 5: 144,689,093 (GRCm39) probably null Het
Trim71 A G 9: 114,392,016 (GRCm39) V57A possibly damaging Het
Twf1 T C 15: 94,483,428 (GRCm39) probably benign Het
Tyro3 T A 2: 119,632,176 (GRCm39) I81N possibly damaging Het
Unc13a A T 8: 72,105,043 (GRCm39) C740S probably damaging Het
Vmn1r15 A T 6: 57,235,616 (GRCm39) K161N probably benign Het
Vmn1r16 A T 6: 57,299,884 (GRCm39) I246N probably damaging Het
Vmn1r42 A G 6: 89,821,597 (GRCm39) I324T probably benign Het
Vmn2r35 T C 7: 7,819,805 (GRCm39) Y155C possibly damaging Het
Wif1 T A 10: 120,919,788 (GRCm39) probably null Het
Wscd2 G A 5: 113,689,231 (GRCm39) R79Q possibly damaging Het
Zan G T 5: 137,404,139 (GRCm39) probably benign Het
Zfp9 G T 6: 118,442,021 (GRCm39) H214N probably benign Het
Zfp985 A T 4: 147,667,315 (GRCm39) Y61F probably benign Het
Zscan30 A G 18: 24,104,524 (GRCm39) noncoding transcript Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 75,999,567 (GRCm39) missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76,017,508 (GRCm39) missense probably benign 0.00
IGL02629:Slc5a4a APN 10 75,983,413 (GRCm39) missense unknown
IGL02976:Slc5a4a APN 10 76,006,527 (GRCm39) missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 75,986,346 (GRCm39) missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 75,986,386 (GRCm39) missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76,014,031 (GRCm39) missense probably null 0.00
R0244:Slc5a4a UTSW 10 76,024,986 (GRCm39) missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76,018,556 (GRCm39) missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76,012,368 (GRCm39) missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76,013,995 (GRCm39) missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76,022,362 (GRCm39) missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76,025,103 (GRCm39) splice site probably null
R1857:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76,002,569 (GRCm39) missense probably benign 0.27
R1942:Slc5a4a UTSW 10 75,983,422 (GRCm39) missense unknown
R2016:Slc5a4a UTSW 10 75,989,414 (GRCm39) missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76,013,915 (GRCm39) splice site probably null
R3420:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76,012,407 (GRCm39) missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76,024,983 (GRCm39) missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76,017,489 (GRCm39) missense probably benign 0.42
R4523:Slc5a4a UTSW 10 75,984,196 (GRCm39) missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4538:Slc5a4a UTSW 10 76,013,929 (GRCm39) nonsense probably null
R4755:Slc5a4a UTSW 10 76,022,398 (GRCm39) missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76,014,065 (GRCm39) missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 75,983,428 (GRCm39) missense unknown
R5254:Slc5a4a UTSW 10 76,018,572 (GRCm39) nonsense probably null
R6083:Slc5a4a UTSW 10 75,983,431 (GRCm39) missense unknown
R6331:Slc5a4a UTSW 10 76,014,034 (GRCm39) missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 75,983,501 (GRCm39) critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 75,983,384 (GRCm39) missense unknown
R8785:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76,006,617 (GRCm39) missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76,022,369 (GRCm39) missense probably benign 0.15
R9018:Slc5a4a UTSW 10 76,002,546 (GRCm39) missense possibly damaging 0.67
R9474:Slc5a4a UTSW 10 75,986,238 (GRCm39) critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76,022,396 (GRCm39) missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76,002,608 (GRCm39) missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76,018,681 (GRCm39) nonsense probably null
Z1177:Slc5a4a UTSW 10 76,002,578 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATTTGACCTGTTGCCAGTGG -3'
(R):5'- ACACGCATGCGCACTTACTC -3'

Sequencing Primer
(F):5'- CACAGAAAGCCATGGATCAGG -3'
(R):5'- ATGCGCACTTACTCACTTACCTGG -3'
Posted On 2014-06-23