Incidental Mutation 'R1858:Igsf5'
ID 206381
Institutional Source Beutler Lab
Gene Symbol Igsf5
Ensembl Gene ENSMUSG00000000159
Gene Name immunoglobulin superfamily, member 5
Synonyms Igsf5, Jam4, 2010003D20Rik
MMRRC Submission 039882-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R1858 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 96162868-96223321 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to T at 96187829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000163] [ENSMUST00000000163] [ENSMUST00000081093] [ENSMUST00000081093] [ENSMUST00000113794] [ENSMUST00000113794] [ENSMUST00000113795] [ENSMUST00000113795]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000000163
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000000163
SMART Domains Protein: ENSMUSP00000000163
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081093
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081093
SMART Domains Protein: ENSMUSP00000079874
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113794
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113794
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139595
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 12,045,177 (GRCm39) A443E unknown Het
Acacb A T 5: 114,334,770 (GRCm39) Y613F probably benign Het
Adam23 A C 1: 63,596,615 (GRCm39) I566L probably benign Het
Adar G T 3: 89,646,589 (GRCm39) R338L probably benign Het
Akap14 C T X: 36,420,779 (GRCm39) A476T probably damaging Het
Amotl1 T A 9: 14,486,697 (GRCm39) Q399L probably benign Het
Ankrd16 T G 2: 11,783,407 (GRCm39) L3R probably benign Het
Arfgap1 G C 2: 180,615,881 (GRCm39) G187R probably damaging Het
Arhgap19 A T 19: 41,767,592 (GRCm39) V399D probably benign Het
Arl4d A G 11: 101,557,578 (GRCm39) T35A probably damaging Het
Atr T A 9: 95,747,150 (GRCm39) I144N probably damaging Het
Bptf A G 11: 106,964,127 (GRCm39) M1574T probably benign Het
Cacna1h T A 17: 25,599,781 (GRCm39) D1684V probably damaging Het
Celsr1 C A 15: 85,916,960 (GRCm39) V338F probably damaging Het
Cep164 T C 9: 45,734,938 (GRCm39) probably benign Het
Clock C A 5: 76,388,756 (GRCm39) G390C possibly damaging Het
Col6a6 A G 9: 105,658,301 (GRCm39) F637S probably damaging Het
Crebrf T A 17: 26,961,937 (GRCm39) Y345N probably benign Het
Cstdc3 A T 16: 36,128,449 (GRCm39) I15F probably damaging Het
Cul1 A G 6: 47,502,458 (GRCm39) probably null Het
Cyb5r4 C T 9: 86,923,332 (GRCm39) S185L probably benign Het
Cyp3a57 T C 5: 145,318,059 (GRCm39) Y347H probably damaging Het
Dgkq G T 5: 108,801,597 (GRCm39) T487K probably benign Het
Dmkn T C 7: 30,463,990 (GRCm39) V143A probably benign Het
Dmp1 A T 5: 104,355,496 (GRCm39) E32V possibly damaging Het
Dsc3 T C 18: 20,098,773 (GRCm39) D802G probably damaging Het
Dse T C 10: 34,029,225 (GRCm39) T622A probably benign Het
Duxf4 A G 10: 58,071,602 (GRCm39) V204A probably benign Het
Dyrk1b A T 7: 27,882,071 (GRCm39) probably null Het
Ehd2 T C 7: 15,686,113 (GRCm39) T320A probably benign Het
Eif3a A C 19: 60,770,635 (GRCm39) L71V probably damaging Het
Eif4e1b A G 13: 54,935,091 (GRCm39) probably null Het
Fam131b A G 6: 42,295,914 (GRCm39) F161L probably damaging Het
Fam171b A T 2: 83,683,725 (GRCm39) M81L probably benign Het
Gal3st4 T C 5: 138,269,050 (GRCm39) probably null Het
Gdf11 A T 10: 128,722,315 (GRCm39) V180E probably damaging Het
Grin3a T A 4: 49,792,437 (GRCm39) Y432F probably benign Het
Hif1a C A 12: 73,990,929 (GRCm39) H708N probably benign Het
Hmcn2 G T 2: 31,305,295 (GRCm39) probably null Het
Hs3st6 T A 17: 24,976,973 (GRCm39) M151K possibly damaging Het
Hyal2 T A 9: 107,449,537 (GRCm39) L431Q probably benign Het
Hyal6 A T 6: 24,740,857 (GRCm39) T337S probably benign Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Krtap19-3 G A 16: 88,674,878 (GRCm39) probably benign Het
Lgalsl T C 11: 20,779,420 (GRCm39) D75G probably benign Het
Lrrc56 A G 7: 140,787,421 (GRCm39) M353V probably benign Het
Ltbp2 T A 12: 84,877,555 (GRCm39) K337* probably null Het
Mdn1 C T 4: 32,730,881 (GRCm39) H2917Y probably benign Het
Medag A G 5: 149,353,259 (GRCm39) I151M probably damaging Het
Meiob T C 17: 25,042,544 (GRCm39) V124A probably damaging Het
Mmp3 A G 9: 7,451,799 (GRCm39) H379R probably benign Het
Mpg A G 11: 32,181,957 (GRCm39) probably null Het
Ncoa6 G T 2: 155,263,559 (GRCm39) Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 (GRCm39) H277Q probably benign Het
Nlrp4c A G 7: 6,087,655 (GRCm39) I763V probably benign Het
Nlrp5 A T 7: 23,117,586 (GRCm39) I437F probably damaging Het
Noc2l G A 4: 156,329,727 (GRCm39) R435Q probably damaging Het
Nova2 T C 7: 18,692,326 (GRCm39) I485T probably damaging Het
Nrxn2 G A 19: 6,538,825 (GRCm39) V794I probably benign Het
Nup210l A G 3: 90,061,806 (GRCm39) T662A probably damaging Het
Or2ad1 A T 13: 21,326,564 (GRCm39) I221N probably damaging Het
Or2b28 A G 13: 21,531,346 (GRCm39) M83V possibly damaging Het
Or2p2 A T 13: 21,256,641 (GRCm39) F277I probably damaging Het
Or51aa2 G A 7: 103,187,859 (GRCm39) T194I probably damaging Het
Or51e2 A C 7: 102,391,571 (GRCm39) I213S probably damaging Het
Or51l14 G A 7: 103,101,332 (GRCm39) V263I probably benign Het
Or9g8 T C 2: 85,607,582 (GRCm39) L218P probably damaging Het
Pelp1 G A 11: 70,285,568 (GRCm39) P767S probably damaging Het
Pfdn1 C A 18: 36,584,153 (GRCm39) M60I probably benign Het
Plaat1 G A 16: 29,036,470 (GRCm39) G36D probably damaging Het
Plcxd3 T A 15: 4,546,093 (GRCm39) probably benign Het
Plekhg1 C A 10: 3,895,917 (GRCm39) D436E possibly damaging Het
Ppfibp1 G A 6: 146,892,090 (GRCm39) V117I probably benign Het
Prss44 A G 9: 110,643,177 (GRCm39) K24R probably benign Het
Ptger1 G T 8: 84,395,107 (GRCm39) G195W probably benign Het
Ptgs1 A C 2: 36,132,782 (GRCm39) D260A probably benign Het
Ptprd T A 4: 75,865,384 (GRCm39) T1198S probably damaging Het
Qsox2 A G 2: 26,104,074 (GRCm39) S319P probably damaging Het
Rab35 A G 5: 115,778,147 (GRCm39) I38V probably damaging Het
Rapgef4 A G 2: 71,861,408 (GRCm39) I33V possibly damaging Het
Rbbp8nl C T 2: 179,924,006 (GRCm39) probably benign Het
Riok1 A T 13: 38,242,694 (GRCm39) K473* probably null Het
Rtca C T 3: 116,287,764 (GRCm39) G288S probably benign Het
Sag A T 1: 87,742,570 (GRCm39) D114V probably benign Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sec61g A G 11: 16,456,371 (GRCm39) probably null Het
Sf3a3 A T 4: 124,623,288 (GRCm39) I440F probably damaging Het
Sgta T C 10: 80,884,695 (GRCm39) K205E possibly damaging Het
Slc36a4 A G 9: 15,632,006 (GRCm39) T61A probably damaging Het
Slc5a4a T C 10: 76,002,569 (GRCm39) S242P probably benign Het
Srgap3 A T 6: 112,748,479 (GRCm39) L391Q probably damaging Het
Stard13 T C 5: 151,018,903 (GRCm39) Y60C probably damaging Het
Styxl2 T C 1: 165,928,415 (GRCm39) Y399C possibly damaging Het
Syt12 G T 19: 4,497,825 (GRCm39) H386N probably damaging Het
Thyn1 T A 9: 26,915,070 (GRCm39) M74K probably benign Het
Tmem130 C A 5: 144,689,093 (GRCm39) probably null Het
Trim71 A G 9: 114,392,016 (GRCm39) V57A possibly damaging Het
Twf1 T C 15: 94,483,428 (GRCm39) probably benign Het
Tyro3 T A 2: 119,632,176 (GRCm39) I81N possibly damaging Het
Unc13a A T 8: 72,105,043 (GRCm39) C740S probably damaging Het
Vmn1r15 A T 6: 57,235,616 (GRCm39) K161N probably benign Het
Vmn1r16 A T 6: 57,299,884 (GRCm39) I246N probably damaging Het
Vmn1r42 A G 6: 89,821,597 (GRCm39) I324T probably benign Het
Vmn2r35 T C 7: 7,819,805 (GRCm39) Y155C possibly damaging Het
Wif1 T A 10: 120,919,788 (GRCm39) probably null Het
Wscd2 G A 5: 113,689,231 (GRCm39) R79Q possibly damaging Het
Zan G T 5: 137,404,139 (GRCm39) probably benign Het
Zfp9 G T 6: 118,442,021 (GRCm39) H214N probably benign Het
Zfp985 A T 4: 147,667,315 (GRCm39) Y61F probably benign Het
Zscan30 A G 18: 24,104,524 (GRCm39) noncoding transcript Het
Other mutations in Igsf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Igsf5 APN 16 96,192,220 (GRCm39) missense possibly damaging 0.72
IGL01335:Igsf5 APN 16 96,174,353 (GRCm39) splice site probably benign
IGL02576:Igsf5 APN 16 96,187,781 (GRCm39) missense probably benign 0.23
IGL02721:Igsf5 APN 16 96,192,222 (GRCm39) missense probably damaging 0.98
IGL03289:Igsf5 APN 16 96,326,632 (GRCm39) missense possibly damaging 0.94
R0630:Igsf5 UTSW 16 96,174,023 (GRCm39) splice site probably benign
R1961:Igsf5 UTSW 16 96,179,551 (GRCm39) missense probably damaging 1.00
R2508:Igsf5 UTSW 16 96,165,247 (GRCm39) missense probably benign 0.01
R4491:Igsf5 UTSW 16 96,165,281 (GRCm39) missense probably benign 0.02
R5123:Igsf5 UTSW 16 96,174,279 (GRCm39) missense probably damaging 1.00
R5262:Igsf5 UTSW 16 96,192,237 (GRCm39) nonsense probably null
R5384:Igsf5 UTSW 16 96,192,226 (GRCm39) missense probably benign 0.21
R5558:Igsf5 UTSW 16 96,187,731 (GRCm39) missense possibly damaging 0.95
R5950:Igsf5 UTSW 16 96,174,072 (GRCm39) missense probably benign 0.07
R5957:Igsf5 UTSW 16 96,165,249 (GRCm39) missense probably benign 0.10
R6199:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R6298:Igsf5 UTSW 16 96,197,648 (GRCm39) missense possibly damaging 0.93
R7164:Igsf5 UTSW 16 96,174,048 (GRCm39) missense possibly damaging 0.85
R7197:Igsf5 UTSW 16 96,204,546 (GRCm39) missense probably damaging 1.00
R8213:Igsf5 UTSW 16 96,174,188 (GRCm39) missense probably damaging 1.00
R8353:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8453:Igsf5 UTSW 16 96,222,996 (GRCm39) missense probably benign 0.00
R8823:Igsf5 UTSW 16 96,222,939 (GRCm39) missense possibly damaging 0.66
R9798:Igsf5 UTSW 16 96,174,075 (GRCm39) missense probably damaging 1.00
Z1176:Igsf5 UTSW 16 96,192,223 (GRCm39) missense probably damaging 1.00
Z1177:Igsf5 UTSW 16 96,179,533 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGTACATCACTAAACTCTTTCTTTC -3'
(R):5'- GTATGTGCATATACATGTTTGTGTACA -3'

Sequencing Primer
(F):5'- CTCTTGCTCTTGTAGACAGTATTG -3'
(R):5'- ATGCATGCAGTTGATGGACACTC -3'
Posted On 2014-06-23