Mutagenetix > Incidental Mutation

Incidental Mutation 'E0370:Slc9a2'

206396

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

E0370 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 40763541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231]

AlphaFold

Q3ZAS0

Predicted Effect

probably null
Transcript: ENSMUST00000027231

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Meta Mutation Damage Score

0.9476

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.1%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	TGCAGCGACTGGACGGCGGCA	TGCA	11: 70,616,426		probably null	Het
Aire	T	A	10: 78,042,063	N180I	probably damaging	Het
Asic3	G	T	5: 24,413,987	L92F	probably damaging	Het
Birc6	G	A	17: 74,677,357	D4455N	probably damaging	Het
Cd36	A	T	5: 17,785,749	C464*	probably null	Het
Cdx1	A	C	18: 61,020,429	I179S	probably damaging	Het
D430042O09Rik	A	G	7: 125,850,302	D846G	probably benign	Het
Dnah2	A	T	11: 69,515,615		probably null	Het
Dst	A	T	1: 34,249,471		probably benign	Het
Epb41l3	A	G	17: 69,274,804	N580S	possibly damaging	Het
Hnrnpm	A	T	17: 33,658,922		probably benign	Het
Map2	A	T	1: 66,416,724		probably benign	Het
Mapk11	T	C	15: 89,146,513	D88G	probably damaging	Het
Marc1	T	C	1: 184,795,228		probably benign	Het
Mbd4	C	T	6: 115,849,155	E271K	possibly damaging	Het
Mpp4	T	G	1: 59,139,758		probably benign	Het
Muc2	T	C	7: 141,696,355	Y609H	probably damaging	Het
Olfr918	A	T	9: 38,672,561	D307E	probably damaging	Het
Pex1	T	A	5: 3,631,614		probably null	Het
Prdm11	T	C	2: 92,980,579	Y225C	probably damaging	Het
Psmc3	T	A	2: 91,055,118		probably null	Het
Slc26a8	A	T	17: 28,642,387	D774E	possibly damaging	Het
Smc1b	A	G	15: 85,127,581	Y168H	probably damaging	Het
Steap1	T	C	5: 5,740,673	R92G	probably damaging	Het
Tbx22	T	C	X: 107,685,153	I430T	probably benign	Het
Tfap4	T	A	16: 4,559,470	H16L	possibly damaging	Het
Tnxb	A	G	17: 34,678,943	D855G	probably damaging	Het
Trip13	A	G	13: 73,920,439		probably benign	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Vmn2r121	A	G	X: 124,127,920	V801A	probably benign	Het
Wiz	C	T	17: 32,355,118	R935Q	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9028:Slc9a2	UTSW	1	40726452	missense	probably damaging	1.00
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTAACGGGAATGGCTTTATCAC -3'
(R):5'- GAGAAACTTACTCATGGAGCCC -3'

Sequencing Primer
(F):5'- GGGAATGGCTTTATCACTGAAATAAG -3'
(R):5'- CCCAGCTGGAAAGCATGGTTTTAG -3'

Posted On

2014-06-23