Incidental Mutation 'R0114:Alms1'
ID 20640
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene Name ALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 038400-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0114 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 6
Chromosomal Location 85587531-85702753 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85619803 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 537 (L537P)
Ref Sequence ENSEMBL: ENSMUSP00000071904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072018
AA Change: L537P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: L537P

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213058
AA Change: L1006P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
butterball UTSW 6 85696771 missense probably damaging 0.99
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
replete UTSW 6 85629208 missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2566:Alms1 UTSW 6 85622482 missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 splice site probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
R7334:Alms1 UTSW 6 85641450 missense probably damaging 0.99
R7376:Alms1 UTSW 6 85622106 missense probably benign 0.10
R7394:Alms1 UTSW 6 85622223 missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85628306 missense probably benign 0.03
R7511:Alms1 UTSW 6 85609425 missense unknown
R7542:Alms1 UTSW 6 85629362 missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85620412 missense probably damaging 1.00
R7575:Alms1 UTSW 6 85622159 missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85615320 missense probably benign 0.09
R7618:Alms1 UTSW 6 85678417 missense probably benign 0.07
R7653:Alms1 UTSW 6 85620595 missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85615351 missense probably damaging 1.00
R7807:Alms1 UTSW 6 85622976 missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85615358 missense probably benign 0.42
R7849:Alms1 UTSW 6 85621497 missense possibly damaging 0.48
R7944:Alms1 UTSW 6 85641380 missense probably benign 0.03
R7954:Alms1 UTSW 6 85621162 missense probably damaging 0.98
R7971:Alms1 UTSW 6 85628679 missense probably benign
R8048:Alms1 UTSW 6 85641334 missense probably benign 0.13
R8223:Alms1 UTSW 6 85643240 nonsense probably null
R8332:Alms1 UTSW 6 85620579 missense probably benign 0.05
R8374:Alms1 UTSW 6 85608991 missense probably benign 0.41
R8470:Alms1 UTSW 6 85641375 missense probably damaging 0.99
R8755:Alms1 UTSW 6 85621574 missense probably benign 0.01
R8979:Alms1 UTSW 6 85621027 missense probably damaging 0.98
R9044:Alms1 UTSW 6 85696753 missense probably damaging 0.98
R9057:Alms1 UTSW 6 85609832 missense unknown
R9224:Alms1 UTSW 6 85621788 missense possibly damaging 0.69
R9259:Alms1 UTSW 6 85667891 missense possibly damaging 0.94
R9401:Alms1 UTSW 6 85678019 nonsense probably null
R9459:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R9633:Alms1 UTSW 6 85623143 missense probably damaging 0.99
R9716:Alms1 UTSW 6 85601252 missense possibly damaging 0.84
R9730:Alms1 UTSW 6 85629438 missense probably benign 0.00
R9790:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9791:Alms1 UTSW 6 85619443 missense probably benign 0.04
R9802:Alms1 UTSW 6 85629238 missense possibly damaging 0.61
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85678418 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GAGATTCGGAAAGTGTCACCTGCTC -3'
(R):5'- ACACGACTGTCTGGCAACTCTTG -3'

Sequencing Primer
(F):5'- GAGATGCTACCAGTACAATCTAGTTC -3'
(R):5'- GGCAACTCTTGGTGGTAAATATTAGC -3'
Posted On 2013-04-11