Incidental Mutation 'E0370:Marc1'
ID206400
Institutional Source Beutler Lab
Gene Symbol Marc1
Ensembl Gene ENSMUSG00000026621
Gene Namemitochondrial amidoxime reducing component 1
Synonyms1300013F15Rik, Mosc1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #E0370 (G1)
Quality Score221
Status Validated
Chromosome1
Chromosomal Location184786767-184811313 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 184795228 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048462] [ENSMUST00000110992] [ENSMUST00000189492]
Predicted Effect probably benign
Transcript: ENSMUST00000048462
SMART Domains Protein: ENSMUSP00000035804
Gene: ENSMUSG00000026621

DomainStartEndE-ValueType
transmembrane domain 25 44 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
Pfam:MOSC_N 58 179 1e-39 PFAM
Pfam:MOSC 195 337 3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110992
SMART Domains Protein: ENSMUSP00000106620
Gene: ENSMUSG00000026621

DomainStartEndE-ValueType
transmembrane domain 25 44 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
Pfam:MOSC_N 58 179 1.7e-40 PFAM
Pfam:MOSC 205 338 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189492
SMART Domains Protein: ENSMUSP00000139716
Gene: ENSMUSG00000026621

DomainStartEndE-ValueType
Pfam:MOSC_N 1 74 4.2e-15 PFAM
Pfam:MOSC 90 232 3.5e-28 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Marc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Marc1 APN 1 184807180 missense probably damaging 1.00
IGL01985:Marc1 APN 1 184787734 missense probably damaging 1.00
PIT1430001:Marc1 UTSW 1 184807049 missense probably benign
PIT4366001:Marc1 UTSW 1 184807186 missense probably benign 0.10
R1335:Marc1 UTSW 1 184803941 missense probably benign 0.01
R1538:Marc1 UTSW 1 184802002 missense probably damaging 0.99
R2139:Marc1 UTSW 1 184795435 missense probably benign 0.17
R4591:Marc1 UTSW 1 184807168 missense probably benign 0.10
R5642:Marc1 UTSW 1 184810919 missense probably damaging 1.00
R6251:Marc1 UTSW 1 184795451 missense probably damaging 1.00
R6370:Marc1 UTSW 1 184795492 missense probably damaging 1.00
R7095:Marc1 UTSW 1 184795240 missense probably damaging 1.00
Z1177:Marc1 UTSW 1 184803937 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TATAGGCAGTATGGAACCCTGGG -3'
(R):5'- ATGGCTTGTACCCGGTAAGAC -3'

Sequencing Primer
(F):5'- TGGAACCCTGGGCATAATTATC -3'
(R):5'- GGTAAGACCCTTTCCTGTCATGG -3'
Posted On2014-06-23