Incidental Mutation 'E0370:Psmc3'
ID 206401
Institutional Source Beutler Lab
Gene Symbol Psmc3
Ensembl Gene ENSMUSG00000002102
Gene Name proteasome (prosome, macropain) 26S subunit, ATPase 3
Synonyms Tat binding protein 1, TBP-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # E0370 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 91054009-91066369 bp(+) (GRCm38)
Type of Mutation splice site (14 bp from exon)
DNA Base Change (assembly) T to A at 91055118 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002171] [ENSMUST00000067663] [ENSMUST00000111441] [ENSMUST00000185715]
AlphaFold O88685
Predicted Effect probably null
Transcript: ENSMUST00000002171
SMART Domains Protein: ENSMUSP00000002171
Gene: ENSMUSG00000002102

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067663
SMART Domains Protein: ENSMUSP00000071054
Gene: ENSMUSG00000002102

DomainStartEndE-ValueType
AAA 222 361 6.65e-22 SMART
Blast:AAA 390 436 9e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111441
SMART Domains Protein: ENSMUSP00000107068
Gene: ENSMUSG00000002102

DomainStartEndE-ValueType
AAA 180 319 6.65e-22 SMART
Blast:AAA 348 394 8e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145317
Predicted Effect probably benign
Transcript: ENSMUST00000146506
SMART Domains Protein: ENSMUSP00000121688
Gene: ENSMUSG00000002102

DomainStartEndE-ValueType
PDB:4CR4|M 13 183 2e-69 PDB
Blast:AAA 140 183 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152269
Predicted Effect probably null
Transcript: ENSMUST00000185715
SMART Domains Protein: ENSMUSP00000139782
Gene: ENSMUSG00000002102

DomainStartEndE-ValueType
AAA 203 301 9e-14 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Psmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0747:Psmc3 UTSW 2 91054300 missense probably benign 0.10
R1182:Psmc3 UTSW 2 91056035 missense probably damaging 1.00
R1763:Psmc3 UTSW 2 91055995 missense possibly damaging 0.81
R1967:Psmc3 UTSW 2 91057844 missense probably benign 0.19
R2056:Psmc3 UTSW 2 91058088 missense probably benign 0.40
R2484:Psmc3 UTSW 2 91056001 missense probably damaging 0.97
R3411:Psmc3 UTSW 2 91055918 missense probably damaging 1.00
R3608:Psmc3 UTSW 2 91054580 missense probably benign 0.00
R4917:Psmc3 UTSW 2 91065972 unclassified probably benign
R4954:Psmc3 UTSW 2 91055629 intron probably benign
R5033:Psmc3 UTSW 2 91054608 missense probably benign 0.03
R5073:Psmc3 UTSW 2 91054570 splice site probably benign
R5279:Psmc3 UTSW 2 91054322 missense probably benign
R5354:Psmc3 UTSW 2 91059353 missense probably damaging 1.00
R6169:Psmc3 UTSW 2 91057839 missense probably damaging 1.00
R6224:Psmc3 UTSW 2 91054630 missense probably damaging 1.00
R7039:Psmc3 UTSW 2 91055046 missense probably benign 0.32
R7275:Psmc3 UTSW 2 91055930 missense probably damaging 0.97
R7962:Psmc3 UTSW 2 91056662 missense possibly damaging 0.80
Predicted Primers
Posted On 2014-06-23